Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Danio rerio (zebrafish) dre-miR-29b URS00004D1411_7955

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

dre-miR-29b: dre-mir-29b is a microRNA that is induced by cold shock and has been found to target the per2 gene in zebrafish larvae [PMC5111229]. The expression of dre-mir-29b increases initially after cold shock but then drops at 24 hours post-infection [PMC5111229]. There is a correlation between the expression of dre-mir-29b and per2, with dre-mir-29b acting as an inhibitor of per2 expression [PMC5111229]. The 3' untranslated region (UTR) of per2, which contains the target site for dre-mir-29b, has been amplified from a cDNA library [PMC5111229]. The changes in the expression of dre-mir-29b and other cold-affected miRNAs have been validated using qPCR analysis and compared to small RNA-seq results [PMC5111229]. It has been shown that dre-mir-29b can enhance the cold tolerance of zebrafish larvae by fine-tuning the expression of per2 [PMC5111229]. The expression levels of both dre-mir-29b and per2 are elevated at 4 hours post-infection [PMC5111229]. By using a morpholino oligonucleotide (MO) to inhibit dre-mir-29b, it has been demonstrated that it can control the expression of per2 induced by cold shock [PMC5111229]. Dre-miR-101a and dre-miR-101a are also involved in regulating EMT-related genes in zebrafish larvae [PMC7756072]. Dre-miR-29a mimic or Dre-miR-29b mimic have been microinjected into zebrafish embryos to study their effects on gene regulation [PMC5304403].

mRNA interactions 5 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAGCACCAUUUGAAAUCAGUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 18 other species

  1. Eptatretus burgeri Ebu-Mir-29-P1f_3p (mature (guide))
  2. Gadus morhua (Atlantic cod) gmo-miR-29b-3p
  3. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-29b
  4. Monodelphis domestica (gray short-tailed opossum) mdo-miR-29b-3p
  5. Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-72546
  6. Oreochromis niloticus (Nile tilapia) oni-miR-29b
  7. Ornithorhynchus anatinus (platypus) oan-miR-29b-3p
  8. Oryzias latipes ola-miR-29b
  9. Ovis aries oar-miR-29b
  10. Petromyzon marinus pma-miR-29c
  11. Ptychodera flava Pfl-Mir-29-P1_3p (mature (guide))
  12. Pundamilia nyererei pny-miR-29b
  13. Rattus norvegicus Rattus_norvegicus piRNA piR-rno-62878
  14. Saccoglossus kowalevskii sko-miR-29b-3p
  15. Scyliorhinus torazame Sto-Mir-29-P1b_3p (mature (guide))
  16. Takifugu rubripes (torafugu) fru-miR-29b
  17. Tetraodon nigroviridis tni-miR-29b
  18. Tor tambroides (Thai mahseer) miR-29b
Publications