Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) focally amplified long non-coding RNA in epithelial cancer URS00004CE22A_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

FALEC: Focally amplified long non-coding RNA in epithelial cancer (FALEC) is a type of long non-coding RNA that is overexpressed in melanoma tissues and cell lines compared to healthy controls [PMC8508152]. Its higher expression has been associated with poor patients' survival and TNM staging [PMC8508152]. In gastric cancer (GC), a negative correlation was found between the expression of FALEC and miR-203b [PMC9201125]. FALEC overexpression in SCC-9 and CAL-27 cells was shown to significantly reduce cell proliferation rate (Ki-67) and increase the rate of apoptosis (TUNEL) in xenografted tumors [PMC6682530]. To confirm that FALEC's functional target was ECM1, a rescue experiment was conducted in GC cells [PMC6448009]. FALEC, a type of long non-coding RNA, has been found to be overexpressed in melanoma tissues and cell lines compared to healthy controls, with its higher expression associated with poor patients' survival and TNM staging [PMC8508152]. In gastric cancer, there is a negative correlation between the expression of FALEC and miR-203b [PMC9201125]. Additionally, FALEC overexpression has been shown to reduce cell proliferation rate (Ki-67) and increase apoptosis rate (TUNEL) in SCC-9 and CAL-27 cells xenografted tumors [PMC6682530]. Furthermore, a rescue experiment conducted in GC cells confirmed that ECM1 is the functional target of FALEC [PMC6448009].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCGCAUCUCCUACGGCCUCCAGGACAGAGGAACCGGGGGAGGCAGGGGGAAAAGGCCGGCCCAGCAAUUCCCCUACCCCCCGGUCCCACGUGUACCCUCCUGGCCUGGGUCGCCCCAGCCCACGGGGAGCGGGCGGAGUCCUGGCCCACGAAGCCUUGUCACCUGGCGGGCGAAUCCGCAAGCGGAGACUUGUCUUUAAAGGGCUUUGGGCCGGGCGCGGUGGCUCAUGCCUGGAAUCCCAGCACUUUGGGAGGCCGAGGCGGUGGAUCACGAGGUCAGGAGUUCAAGACCAGCCUGGCCAAGAAGCUCAUACUGACUAAGGCAGCAGAACAUACAGGAGGAAGAGGAGCAGGUUUCACAGAGGGAAGACAUGAGUUCAAUUUUGGACUUCUCAGUAGUCGGUGUCCUCAGUGGUAGCAACUUCAAACGGAAGGUGUCAAAAGUCAAAUUCUGGAGAGUUGAGUAUGAAUGGGAGAUGAAGAAAAGGAGGCAGCACUUGUAGCCUGCUCUUAAUGUAUUUCUGCACUCUACACUAGCAGCCUAUUACACAGGACACUUGGAUGUCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Expression New Publications