Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-148a precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-148a precursor URS00004C7B32_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR148A: MIR148A is a microRNA that has been studied for its role in protein regulation and target identification in cell lines, but it was found to have minimal protein regulation and no identified protein targets [PMC10057657]. The liver detargeting effects of MIR148A are not only due to its binding to target sites, but also because other members of the MIR148/152 family, such as miR-148b and miR-152, can recognize MIR148A target sites and downregulate transgenes [PMC4467430]. The effects of psychotropics on various miRNAs, including MIR148A, as well as on the REST gene, should be studied in Huntington's disease models [PMC3856079]. DNMT1 is a predicted target of MIR148A and its expression is elevated in adipocytes of obese individuals [PMC6817687]. Dysregulated expression of several miRNAs, including MIR148A, has been found in immune cells from patients with lupus and is associated with dysregulated inflammatory function [PMC7139533]. MIR148A is a microRNA that has minimal protein regulation and no identified protein targets in cell lines [PMC10057657]. It can be detargeted by other members of the MIR148/152 family such as miR-148b and miR-152 [PMC4467430]. The effects of psychotropics on various miRNAs including MIR148A should be studied in Huntington's disease models [PMC3856079]. DNMT1 is a predicted target for MIR148A and its expression is elevated in adipocytes of obese individuals [PMC6817687]. Dysregulated expression of several miRNAs including MIR148A has been found in immune cells from patients with lupus associated with dysregulated inflammatory function.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GAGGCAAAGUUCUGAGACACUCCGACUCUGAGUAUGAUAGAAGUCAGUGCACUACAGAACUUUGUCUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 26 other species

  1. Aotus nancymaae (Ma's night monkey) miRNA (ENSANAG00000002611.1)
  2. Carlito syrichta miRNA (ENSTSYG00000021283.2)
  3. Castor canadensis miRNA (ENSCCNG00000014739.1)
  4. Cebus imitator microRNA 148a (ENSCCAG00000004264.1)
  5. Cercocebus atys (Sooty mangabey) miRNA (ENSCATG00000015190.1)
  6. Chlorocebus sabaeus (African green monkey) microRNA 148a (ENSCSAG00000020715.1)
  7. Colobus angolensis palliatus (Angola colobus) miRNA (ENSCANG00000003929.1)
  8. Dasypus novemcinctus (nine-banded armadillo) miRNA (ENSDNOG00000045178.1)
  9. Gorilla gorilla gorilla (Western Lowland Gorilla) microRNA 148a (ENSGGOG00000032717.2)
  10. Loxodonta africana (African savanna elephant) microRNA 148a (ENSLAFG00000024489.1)
  11. Macaca mulatta (Rhesus monkey) microRNA mml-mir-148a precursor
  12. Macaca nemestrina (Pig-tailed macaque) miRNA (ENSMNEG00000004641.1)
  13. Mandrillus leucophaeus miRNA (ENSMLEG00000017165.1)
  14. Microcebus murinus microRNA 148a (ENSMICG00000028617.2)
  15. Nomascus leucogenys (Northern white-cheeked gibbon) microRNA 148a (ENSNLEG00000019662.2)
  16. Otolemur garnettii miRNA (ENSOGAG00000017248.1)
  17. Pan paniscus microRNA 148a (ENSPPAG00000013293.1)
  18. Pan troglodytes ptr-mir-148a (ENSPTRG00000027798.3)
  19. Pongo abelii (Sumatran orangutan) miRNA
  20. Pongo pygmaeus microRNA ppy-mir-148a precursor
  21. Propithecus coquereli (Coquerel's sifaka) miRNA (ENSPCOG00000011629.1)
  22. Rhinopithecus bieti miRNA (ENSRBIG00000011558.1)
  23. Rhinopithecus roxellana (Golden snub-nosed monkey) miRNA (ENSRROG00000005740.1)
  24. Saimiri boliviensis boliviensis miRNA (ENSSBOG00000016334.1)
  25. Tupaia belangeri (northern tree shrew) miRNA (ENSTBEG00000017891.1)
  26. Urocitellus parryii mir-148a
2D structure Publications