Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-7 precursor (hsa-mir-7-3) secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-7 precursor (hsa-mir-7-3) URS00004C38BB_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR7-3: MIR7-3 is a gene that encodes a mature miRNA called miR-7 [PMC7918072]. It is one of the three genes, along with MIR7-1 and MIR7-2, that produce mature miR-7 [PMC7918072]. MIR7-3 is located on chromosome 19q13 [PMC7918072]. In a study screening for mutations in miRNA genes related to the hypothalamus-pituitary-gonadal system, no mutations were found in MIR7-3 in patients with normosmic congenital hypogonadotropic hypogonadism (ncHH) [PMC6479198]. The expression of miR-7 in the human pituitary is mainly attributed to MIR7-3, which is located within the intron of the pituitary-specific gene PGSF1 (also known as MIR7-3HG) [PMC6479198] [PMC4600152]. The expression of miR-7 derives from three separate loci in the human genome: MIR7-1, MIR7-2, and MIR 73] [PMC6479198] [PMC4600152]. In humans, mature miR- 73] expression levels are enriched in various regions of the brain, particularly the pituitary gland [PMC4600152].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGAUUAGAGUGGCUGUGGUCUAGUGCUGUGUGGAAGACUAGUGAUUUUGUUGUUCUGAUGUACUACGACAACAAGUCACAGCCGGCCUCAUAGCGCAGACUCCCUUCGAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

2D structure Publications