Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-486-5p URS00004BF1DC_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

Hsa-Mir-486: Hsa-mir-486 is a microRNA that has been studied in various contexts. In a study evaluating its ability to differentiate between healthy children and children with congenital heart disease (CHD) or autism spectrum disorder (ASD), hsa-mir-486 levels did not show a significant correlation between these two populations [PMC5828434]. Another study found that overexpression of hsa-mir-486 enhanced fusion capacity in control myoblasts, but was not powerful enough to rescue the effect of TNF-α [PMC4325962]. In patients with ovarian cancer, hsa-mir-486 was found to be part of a miRNA signature associated with prognosis [PMC8148489]. Hsa-mir-486 was also identified as one of the most important miRNAs in differentiating responders from non-responders in a group [PMC7770508]. Furthermore, hsa-mir-486 is located within the last intron of the ankyrin-1 gene on chromosome 8p11's short arm [PMC9132198]. In another study, hsa-mir-486 was found to be downregulated in a group of miRNAs associated with colorectal cancer [PMC5823624]. These findings highlight the diverse roles and associations of hsa-mir-486 in different biological contexts.

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCCUGUACUGAGCUGCCCCGAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 18 other species

  1. Bos taurus (cattle) bta-miR-486
  2. Canis lupus familiaris Cfa-Mir-486_5p (mature (guide))
  3. Cavia porcellus cpo-miR-486-5p
  4. Cricetulus griseus cgr-miR-486-5p
  5. Dasypus novemcinctus dno-miR-486-5p
  6. Echinops telfairi Ete-Mir-486_5p (mature (guide))
  7. Equus caballus eca-miR-486-5p
  8. Gorilla gorilla gorilla ggo-miR-486 (MIR486)
  9. Gorilla gorilla (western gorilla) ggo-miR-486
  10. Ictidomys tridecemlineatus (thirteen-lined ground squirrel) microRNA miR-486
  11. Macaca fascicularis microRNA miR-486-5p
  12. Macaca mulatta (Rhesus monkey) mml-miR-486-5p
  13. Mus musculus (house mouse) mmu-miR-486b-5p
  14. Pan troglodytes ptr-miR-486
  15. Pongo pygmaeus (Bornean orangutan) ppy-miR-486-5p
  16. Pteropus alecto pal-miR-486a-5p
  17. Rattus norvegicus rno-miR-486
  18. Sus scrofa ssc-miR-486
Publications