Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, C/D box 59A (SNORD59A) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, C/D box 59A (SNORD59A) URS00004BEE5E_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD59A: SNORD59A is a small nucleolar RNA (snoRNA) that has been identified as a tumor immune infiltration-associated snoRNA and a positive prognostic factor in bladder cancer [PMC8844792] [PMC8844792]. It has also been found to be upregulated in clear cell renal cell carcinoma and can be used as a diagnostic marker [PMC8844792]. SNORD59A is one of the snoRNAs that were screened out as tumor immune infiltration-associated snoRNAs and included in the random survival forest (RSF) model construction [PMC8649667]. It is also one of the snoRNAs whose expression levels were significantly reduced in tumors and increased in immune cells, making it a potential prognostic factor for colon cancer patients [PMC10050728]. SNORD59A is located on chromosome 12, along with other snoRNAs such as SNORA2B and SNORD59B, which are upregulated in patients with an extra chromosome 12 [PMC9219770] [PMC3766210]. The expression levels of SNORD59A are inversely proportional to the TIIsno score, indicating its potential role in tumor immune infiltration [PMC8844792]. Additionally, SNORD59A is located upstream of SNORD59B within an intron of the protein-coding transcript encoding ATP synthase subunit d (ATP5PD) [PMC9175010]. Overall, SNORD59A has been identified as an important snoRNA with potential diagnostic and prognostic value in various cancers.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCUUCUAUGAUGAUUUUAUCAAAAUGACUUUCGUUCUUCUGAGUUUGCUGAAGCCACAUUUAGGUACUGAGAAGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications