Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) ARHGAP26 antisense RNA 1 (ARHGAP26-AS1) URS00004B4E7B_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ARHGAP26-AS1: ARHGAP26-AS1 is a long non-coding RNA (lncRNA) that has been identified in various studies [PMC8969905][PMC9154001][PMC8231607][PMC8187926]. It has been found to be significantly linked to the overall survival (OS) of patients with lung adenocarcinoma (LUAD) and is part of a necroptosis-related lncRNA signature [PMC8969905]. Additionally, ARHGAP26-AS1 has been identified as a potential prognostic factor in breast cancer (BC), where higher expression levels of ARHGAP26-AS1 are associated with a favorable prognosis [PMC9154001]. It has also been found to be testis-specific and may play a crucial role in the male reproductive system [PMC8231607]. Furthermore, ARHGAP26-AS1 is one of the immune-related lncRNAs that are differentially expressed and associated with high-risk groups [PMC8187926]. However, there have been no reports on the role of ARHGAP26-AS1 in cancer studies or its association with SARS-CoV-2 infection and male infertility [PMC9385364][PMC9530275]. Overall, these studies highlight the potential significance of ARHGAP26-AS1 as a prognostic marker and its involvement in various biological processes [PMC8969905][PMC9154001][PMC8231607][PMC8187926].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CGGGCAAGGAAACACAAGCUGGCUUACAGGUGGAAUACCUGAGAGUCUCCAGAGAGGACCCAUGACAGACAGCUGAGACAUGGAUGGACACGAGCCCCAGAGAGACUUCAGGUAAUUCUUCUCUUCAAGUAAUGCCUCCCCAACUAGUACAUUCUAUAAGGAUGAGGAUCAUAUCCCUUCAUGCUCACCACUCUAUCCCCAAAGCCCAACACUCUACUGCUUGACUGAGAGCAGGUAUUGCAGAAAGAACAAAGAGAGAGGAAGUUGGGCACUCCAUAAGUCCAUUAGCCUUCAUCAGAGGUGAACCUCCCAACUCAAUGUUUGACAUGUGAAAAAAAAAGCAGAUCUGGCUGGAGCAGAUUCAGAAAACCUCUUAUCUCCCCCAGGCGGAUGAUGUGCCCACCGACCACAUCAGCCACGAAACCCAGCUCAUGGCACCUGGAGCUGAUGAAUGGCCCUGGUGCUGACUGCCCAGAAACCAAUCCGGAAACCAGGCUUCCCACAGAAGAGGCAGCUGGAGAGCCAAGCACUCUUGGACUACAGUCCUAGGCUGGAGCUGCCAAUACAGGCUCUGCCCAGCUAAUCUUCUCUGAGCCUGCAAAUAUUAAACCUGACAUACAGACUCAAGUGAAUCCAGAAAACAGGCUCACAGGGCAGCUGAAAAUUCCAAGUGCCUAAGUGAGAUCCAGUGCGACAGUGGAGCAUGUGUGCGCAGAGGAGACAGGAACAACAACCGGGAUGUCAUGCGGGCGCACUGGGGCUCCUUGUGGCCCCAGUGCACAGAAUUCUGGUGGACCCACCAUGUGUGGGAGCUCAGUGAGACUCAAAGUAAGUGCAAGGCCCUCCUCACACAUCGUACGCUGAAGGUGGAGCACACUGGGAAAAUGUGCAUGCAUCAAGAAGAAAAAUGAAAACUGAUUUUGUGCAACAUUUCCACUGUUCUUGGAAGAAUGAAAUAAAUGCAUAUGAGCUAUGAAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications