Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, H/ACA box 63 (SNORA63) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, H/ACA box 63 (SNORA63) URS00004B4AC7_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORA63: SNORA63 is an orphan pseudouridylation pocket of SNORA63, which is an H/ACA class of snoRNA involved in the processing of eukaryotic pre-rRNA [PMC6984369]. It forms duplexes with mismatches upon binding to 28S rRNA, along with five other chicken snoRNAs [PMC7812872]. SNORA63 is also found in the introns of EIF4A2 and EIF3A genes [PMC8759569]. It is known to be among the most abundant snoRNAs in mammalian cells and is well represented in extracellular vesicles [PMC5669939]. SNORA63 has been identified in various developmental stages and different organs in vertebrates, suggesting its involvement in development [PMC9442344]. In cancer, SNORA63 overexpression has been detected in lung squamous cell carcinoma and head and neck squamous cell carcinoma patients, indicating its potential role in cancer progression [PMC7072173]. Additionally, SNORA63 has been identified as an independent prognostic factor and included in a prognostic risk score model for cancer patients [PMC9454744]. Changes in gene expression were normalized using SNORA63 as a reference gene [PMC7312197]. References: - [PMC6984369]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6984369/ - [PMC7812872]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7812872/ - [PMC8759569]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8759569/ - [PMC5669939]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5669939/ - [PM7072173]: https://www.ncbi.nlm.nih.gov/pmc/articles/PM7072173/ - [PM9454744]: https://www.ncbi.nlm.nih.gov/pmc/articles/PM9454744/ - [PMC7312197]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7312197/ - [PMC9442344]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9442344/

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAAGCAGGAUUCAGACUACAAUAUAGCUGCUAAGUGCUGUGUUGUCGUUCCCCCUGCUUAAAAUAAAGUUGUUUCUUAACUAUACCUGUCUGCUAUUCUCCUGUAGCAGCCAGGGACGCUUGGUCUCAUACAUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications