Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, H/ACA box 32 (SNORA32) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, H/ACA box 32 (SNORA32) URS00004AEC70_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORA32: SNORA32 is a small nucleolar RNA (snoRNA) that acts as a regulatory factor through methylation and pseudouridylation [PMC6767209]. In a study comparing patients with pseudoexfoliation glaucoma (PEXG) and control cataract patients, SNORA32 was found to have statistically significant lower expression in the PEXG group [PMC9454646]. Additionally, the host gene for SNORA32, TMEM63C, was identified as a potential factor in PEX pathogenesis [PMC9454646]. Enrichment analyses revealed that SNORA32 targets the CACNB3 gene, which has similar functions to the CACNA1A gene associated with PEX [PMC9454646]. In another study comparing human periodontal ligament stem cells (hPDLSCs) from patients with periodontal disease and healthy controls, SNORA32 was found to be expressed in hPDLSCs-MOR but not in hPDLSCs-CTR [PMC6767209]. Furthermore, SNORA32 was identified as one of the differentially expressed genes (DEGs) in various studies involving different conditions such as cataract and male fertility [PMC6428308] [PMC6054847] [PMC6123486]. Overall, these findings highlight the potential role of SNORA32 in various biological processes and its association with different diseases.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGUCAUUACCAAGGCUUUUAGAAUGCAGUUUCUCAUUUGCUGUGGACAUGACCAUAAAAAAAUUUCCCAGUAGGUUUUCUAUCUGCUACUUUGCUAGCAAUCAGCUUAUUGGGAACAGUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications