Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-590 precursor URS00004AE041_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR590: MIR590 is a microRNA that has been found to be upregulated in various conditions, including in all pulmonary arterial hypertension (PA) cases [PMC7652879]. The MIR590 gene contains a single estrogen receptor alpha (ERα) binding site in its promoter region, located 1050 base pairs upstream of the transcription start site [PMC6328622]. Antisense oligonucleotides against MIR590 have been shown to reverse its effects [PMC7215603]. MIR590 has also been found to target Tob1 and TGFβR2, suggesting its role in cardiac fibrosis and epithelial-mesenchymal transition (EMT) [PMC9564062] [PMC4626157]. Additionally, MIR590 has been associated with myocarditis and heart failure [PMC9589260]. It has also been shown to regulate Sp1 expression levels and be involved in various downstream sub-networks, including glucose metabolism and microRNA regulation [PMC5210349] [PMC6052129]. In cancer, MIR590 acts as an oncogene by targeting PPM1F and is a prognostic factor for tumor recurrence [PMC8743668]. It is also involved in EMT along with miR182 and miR183 [PMC7575175] [PMC8743668].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAGCCAGUCAGAAAUGAGCUUAUUCAUAAAAGUGCAGUAUGGUGAAGUCAAUCUGUAAUUUUAUGUAUAAGCUAGUCUCUGAUUGAAACAUGCAGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

Publications