Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-10b-3p URS00004AC389_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-10b: Hsa-mir-10b is a specific stem-loop sequence that is associated with the gene family group MIPF0000033: mir-10 family [PMC6751684]. Based on this information, it can be inferred that the mir-10 family may play a role in the control and regulation of metastatic breast cancer [PMC4857245]. In a comparison with 125 miRNAs modulated by polyphenols in alveolar and endothelial cells, it was found that 30 miRNAs were common, including hsa-mir-10b [PMC8279534]. This suggests that hsa-mir-10b may be involved in the cellular response to polyphenols. Additionally, the transcription of hsa-mir-10b has been observed in the MDA-MB-231 cell line [PMC4857245]. This information provides evidence for the expression of hsa-mir-10b in breast cancer cells. Overall, these findings highlight the potential significance of hsa-mir-10b in breast cancer and its potential role as a therapeutic target.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACAGAUUCGAUUCUAGGGGAAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 7 other species

Publications