Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-383 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-383 precursor URS00004A6370_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR383: MIR383 is a bovine miRNA that has been studied for its diagnostic and prognostic value in various diseases, including mastitis, hepatocellular carcinoma (HCC), islet dysfunction in obesity, and non-small cell lung cancer (NSCLC) [PMC8532728] [PMC5339660] [PMC5362709] [PMC3092095] [PMC7236805]. It has been shown to exhibit sensitivity and specificity greater than 80% for differentiating between California Mastitis Test positive (CMT+) milk and normal milk [PMC8532728]. In HCC cell lines, transfection with MIR383 mimics resulted in changes in metabolic parameters related to glycolysis [PMC5339660]. In islets of diet-induced obese mice, MIR383 levels were found to be decreased compared to normal mice [PMC7236805]. MIR383 has also been shown to be involved in the regulation of other miRNAs, such as miR134, miR382, and miR182 in the hippocampus [PMC6647430]. Additionally, MIR383 has been studied in the context of ES cell differentiation and its expression pattern was found to be correlated with Gadd45g expression [PMC4240536]. In NSCLC patients, elevated levels of circulating miRNAs including MIR383 were associated with improved survival outcomes [PMC5505543] [PMC9372196]. Furthermore, upregulation of MIR383 was found to suppress gastric cancer development by inhibiting cyclin E2 expression [PMC9608775]. The genomic region containing MIR383 has also been associated with frequent copy number losses (CNLs) in tumor suppressor genes (TSGs) such as TP53 and other microRNAs on chromosome 8p22 locus including MIR320A and MIR497 were also found near MIR383 [PMC5001246]. MIR383 has been identified as a diagnostic biomarker for head and neck cancers [PMC8446523]. The E2F transcription factor indirectly regulates MIR383 and its positional candidate genes, including SGCZ, TRPM7, and MARCH11 [PMC6624949].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUCCUCAGAUCAGAAGGUGAUUGUGGCUUUGGGUGGAUAUUAAUCAGCCACAGCACUGCCUGGUCAGAAAGAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 36 other species

  1. Ailuropoda melanoleuca microRNA mir-383
  2. Aotus nancymaae (Ma's night monkey) miRNA (ENSANAG00000002513.1, ENSANAG00000002537.1)
  3. Callithrix jacchus (white-tufted-ear marmoset) microRNA mir-383
  4. Camelus ferus microRNA mir-383
  5. Canis lupus familiaris (dog) microRNA mir-383
  6. Capra hircus (Goat) microRNA mir-383 (ENSCHIG00000009498.1)
  7. Carlito syrichta miRNA (ENSTSYG00000023392.2)
  8. Cebus imitator microRNA 383 (ENSCCAG00000011972.1)
  9. Cercocebus atys (Sooty mangabey) miRNA (ENSCATG00000017120.1)
  10. Chlorocebus sabaeus microRNA mir-383
  11. Colobus angolensis palliatus (Angola colobus) miRNA (ENSCANG00000016368.1)
  12. Echinops telfairi miRNA (ENSETEG00000021632.1)
  13. Equus caballus microRNA eca-mir-383 precursor
  14. Gorilla gorilla gorilla microRNA 383 (ENSGGOG00000029461.2)
  15. Gorilla gorilla microRNA mir-383
  16. Loxodonta africana microRNA 383 (ENSLAFG00000023910.2)
  17. Macaca mulatta microRNA mml-mir-383 precursor
  18. Macaca nemestrina (Pig-tailed macaque) miRNA (ENSMNEG00000003955.1)
  19. Mandrillus leucophaeus (Drill) miRNA (ENSMLEG00000012461.1)
  20. Mustela putorius furo microRNA mir-383
  21. Pan paniscus microRNA 383 (ENSPPAG00000005797.1)
  22. Panthera pardus microRNA 383 (ENSPPRG00000014018.1)
  23. Panthera tigris altaica microRNA 383 (ENSPTIG00000002586.1)
  24. Pan troglodytes (chimpanzee) ptr-mir-383 (ENSPTRG00000027823.2)
  25. Papio anubis (Olive baboon) microRNA mir-383
  26. Pongo abelii microRNA mir-383
  27. Pongo pygmaeus microRNA ppy-mir-383 precursor
  28. Procavia capensis (cape rock hyrax) miRNA (ENSPCAG00000019696.1)
  29. Propithecus coquereli (Coquerel's sifaka) miRNA (ENSPCOG00000000472.1)
  30. Pteropus alecto microRNA mir-383
  31. Rhinopithecus bieti miRNA (ENSRBIG00000000689.1)
  32. Rhinopithecus roxellana (Golden snub-nosed monkey) miRNA (ENSRROG00000037259.1)
  33. Saimiri boliviensis boliviensis miRNA (ENSSBOG00000009463.1)
  34. Tupaia belangeri (northern tree shrew) microRNA 383 (ENSTBEG00000018033.1)
  35. Tupaia chinensis microRNA mir-383
  36. Tursiops truncatus microRNA 383 (ENSTTRG00000022798.1)
2D structure Publications