v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Macaca mulatta (Rhesus monkey) microRNA mml-mir-383 precursor secondary structure diagram

Macaca mulatta (Rhesus monkey) microRNA mml-mir-383 precursor URS00004A6370_9544

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CUCCUCAGAUCAGAAGGUGAUUGUGGCUUUGGGUGGAUAUUAAUCAGCCACAGCACUGCCUGGUCAGAAAGAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 36 other species

  1. Ailuropoda melanoleuca microRNA mir-383
  2. Aotus nancymaae (Ma's night monkey) miRNA (ENSANAG00000002513.1, ENSANAG00000002537.1)
  3. Callithrix jacchus (white-tufted-ear marmoset) microRNA mir-383
  4. Camelus ferus microRNA mir-383
  5. Canis lupus familiaris (dog) microRNA mir-383
  6. Capra hircus (Goat) microRNA mir-383 (ENSCHIG00000009498.1)
  7. Carlito syrichta miRNA (ENSTSYG00000023392.2)
  8. Cebus imitator microRNA 383 (ENSCCAG00000011972.1)
  9. Cercocebus atys (Sooty mangabey) miRNA (ENSCATG00000017120.1)
  10. Chlorocebus sabaeus microRNA mir-383
  11. Colobus angolensis palliatus (Angola colobus) miRNA (ENSCANG00000016368.1)
  12. Echinops telfairi miRNA (ENSETEG00000021632.1)
  13. Equus caballus microRNA eca-mir-383 precursor
  14. Gorilla gorilla gorilla microRNA 383 (ENSGGOG00000029461.2)
  15. Gorilla gorilla microRNA mir-383
  16. Homo sapiens microRNA hsa-mir-383 precursor
  17. Loxodonta africana microRNA 383 (ENSLAFG00000023910.2)
  18. Macaca nemestrina (Pig-tailed macaque) miRNA (ENSMNEG00000003955.1)
  19. Mandrillus leucophaeus (Drill) miRNA (ENSMLEG00000012461.1)
  20. Mustela putorius furo microRNA mir-383
  21. Pan paniscus microRNA 383 (ENSPPAG00000005797.1)
  22. Panthera pardus microRNA 383 (ENSPPRG00000014018.1)
  23. Panthera tigris altaica microRNA 383 (ENSPTIG00000002586.1)
  24. Pan troglodytes (chimpanzee) ptr-mir-383 (ENSPTRG00000027823.2)
  25. Papio anubis (Olive baboon) microRNA mir-383
  26. Pongo abelii microRNA mir-383
  27. Pongo pygmaeus microRNA ppy-mir-383 precursor
  28. Procavia capensis (cape rock hyrax) miRNA (ENSPCAG00000019696.1)
  29. Propithecus coquereli (Coquerel's sifaka) miRNA (ENSPCOG00000000472.1)
  30. Pteropus alecto microRNA mir-383
  31. Rhinopithecus bieti miRNA (ENSRBIG00000000689.1)
  32. Rhinopithecus roxellana (Golden snub-nosed monkey) miRNA (ENSRROG00000037259.1)
  33. Saimiri boliviensis boliviensis miRNA (ENSSBOG00000009463.1)
  34. Tupaia belangeri (northern tree shrew) microRNA 383 (ENSTBEG00000018033.1)
  35. Tupaia chinensis microRNA mir-383
  36. Tursiops truncatus microRNA 383 (ENSTTRG00000022798.1)
 2D structure Publications