Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-203b-3p URS00004A26B5_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-203b: Hsa-mir-203b is a microRNA that has been implicated in various aspects of melanoma oncogenesis. It has been found that exo-HOTAIR promotes cell proliferation, migration, and invasion by sequestering hsa-mir-203b [PMC7279016]. In a study identifying critical genomic features contributing to melanoma oncogenesis, hsa-mir-203b was identified as one of the potential genes and microRNAs involved [PMC8450182]. Hsa-mir-203b, along with hsa-mir-205, has also been shown to be able to classify metastatic and primary tumor samples with high accuracy [PMC6823463]. Additionally, hsa-mir-203b has been identified as one of the critical miRNAs in melanoma [PMC7505395]. The expression patterns of hsa-mir-203b have been verified in test data from GSE119794 data [PMC7505395]. Furthermore, Oasis 2 identified hsa-mir-203b as a predicted novel differentially expressed miRNA in melanoma [PMC5813365]. In summary, hsa-mir-203b is a microRNA that plays a role in promoting cell proliferation, migration, and invasion in melanoma. It is also involved in the classification of metastatic and primary tumor samples. The expression patterns of hsa-mir-203b have been verified and it has been identified as a critical miRNA in melanoma oncogenesis. Additionally, it has been predicted as differentially expressed in melanoma by Oasis 2.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUGAACUGUUAAGAACCACUGGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications