Homo sapiens (human) HOXA10 antisense RNA (HOXA10-AS)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) HOXA10 antisense RNA (HOXA10-AS) URS000049D760_9606

1,161 nucleotides
8 databases (ENA, Ensembl, Ensembl/GENCODE, GeneCards, HGNC, LncBook, MalaCards, RefSeq)
Found in 0 other species
65 publications
1. lncRNA
2. antisense lncRNA

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

HOXA10-AS: HOXA10-AS is a long non-coding RNA (lncRNA) that has been found to be frequently upregulated in glioma, suggesting its potential role in the progression of malignant glioma [PMC6151881]. The UPF1 RNA-IP assay confirmed UPF1 protein interaction with the HOXA10-AS transcript, and also revealed UPF1 binding to the TP63 transcript [PMC9300705]. This interaction between UPF1 and HOXA10-AS indicates a potential regulatory mechanism involving lncRNAs in glioma. Additionally, lncRNAs like HOXA10-AS have been shown to act as sponges for miRNAs, suggesting their involvement in cancer proliferation and metastasis [PMC9276040]. Therefore, investigating the network of HOXA10-AS and its targeted miRNA, as well as their effects on cancer progression and response to treatment, could provide valuable insights into potential therapeutic strategies for glioma [PMC9276040]. Understanding the role of lncRNAs like HOXA10-AS in cancer biology is crucial for developing targeted therapies that can effectively inhibit tumor growth and metastasis [PMC6151881].

Targeting miRNAs 1 total

According to LncBase, this RNA is targeted by the following miRNAs:

(human) hsa-miR-550a-3p

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

AAAGAAAGAAGAGAUAAAAGAGGAAGGGAAGACAGGGAAAAGAAGGAAGAAAAGAGAGGCGACUCCUAGCAGCGGCCGAGCUUACAGAGAGAAGGGUGGAGGUGUGUGGUGGAAGGGGAAAGCCGGCCGGCUGGCAAAGCGCUGCGGAGAAAGACACGAGGCUCCUGAGCAGGGAAAGCCGAGGUUGCCACCGCAGGCCUGGCACGACCAGGGCCGUGAUGCCCCGCCCGGCCCGACCCCCGCGCGCAGAGGUACCUGGAGACGAUUUCAACUGAAGUAAUGAAGGCAGUGUCGUGCUGUCGAGAGAAAGGUGGAUCCCAACAACAGGAAACUACCUAAAUCACCGACCAGUUCUGGUGCUGCCCGCGAAGGGCUGCCUCGCCCGCCGCCGCCGCCGCCUCCGCCGCUGCCGCCGCCGCCAAGGAGAGAACCCUGCCAUCGCGCCUGGCCCGGCCCAGCCCAGCCCCUAGGCAACCUGCGCCCGCCAGUGCAACAGAGUGCCCCAGGCGGCCGCAAAUGCGUCAAGGAAGGGGAAGCCACAGGCCCCAGUAAGCCAAAGUCAAGCCCGUUUGCCAACCUGCAUGUCCAUGCCUGUAAGCCCUUCUCUUGGCCAAGGAAGAAAGGAAGAAAGAAAAAAGAAACCCAGGGGCCUGUAUCCCCUGAUUAAACACAGCACAGCACUCCAGGCAGACAUGCCCGGUGGCGGCUCCUUUGCACCAUUGACCUCAGGCCAGACACCUCAGCGCCAACAAUGGGACCUCGGCCUUCCGGCUAGGUUUGCCCCAGGCUGGGCAGGAAACCAGCUCGGCCGAAGACAGGGGCCAUUUCGAGCAGUGGGACCCCAAGACAGCAAACCCAGCCCAGUCAGGACUUGACACUUAGGACAAUAUCUAUCUCUAUAGAAUUUUAGCAUGAUAUGGCUUUUUCCCCCAGAAAACAACAAAUAAACCAGCACCAAGCAAACACAAAGAAACAAAAAGUCAGAACAAACCAGCCCUGCACAGAUGUAACGGCCCAGGAGAUGGCGAGUGUGGGAGGGAGGAACAGGGCUCCAGCACAGGUGCGAGUUCCUGGGCAGAGCCUGAAGACAGAGGGAGGGGACCAGCGCUCGGGAAGUGAAAAAACCGCGUCGCCUGGAGAUUCAUCAGGAAAAAUUAAAGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications