Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-1284 URS00004959F4_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-1284: Hsa-mir-1284 is a microRNA that has been studied in various contexts. It has been cloned into the pRNAU6.1 vector for further analysis [PMC3470565]. Hsa-mir-1284, along with other microRNAs, has been found to target the IL12B 3'UTR sequence [PMC3470565]. However, in a luciferase assay, hsa-mir-1284 did not alter the activity of constructs containing the IL12B+1188A or IL12B+1188C alleles [PMC3470565]. Hsa-mir-1284 was selected for further investigation due to its proximity to a polymorphic site and its conservation among species [PMC3470565]. It has also been identified as one of the top-ranking microRNAs in certain studies [PMC7952531]. Hsa-mir-1284 has been studied in relation to diseases such as colorectal cancer and pancreatic cancer [PMC7962059] [PMC7962059]. It has also been validated through quantitative real-time PCR and found to be influenced by age [PMC6736862] [PMC6281647]. In other studies, hsa-mir-1284 was found to regulate a large number of predicted genes and was used in lentivirus constructs for experimental purposes [PMC4278335] [PMC6535428]. Finally, hsa-mir-1284 was one of the 18 miRNAs used to develop a predictive classification model for treatment response using a machine learning approach called Sequential Minimal Optimization (SMO) classifier. Other miRNAs included hsa-miR-185-5p and hsa-miR-20a-5p among others[ PMC8706948].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCUAUACAGACCCUGGCUUUUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

  1. Pan troglodytes ptr-miR-1284
  2. Pongo pygmaeus ppy-miR-1284
Publications