v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-370-3p URS00004900F1_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-370: Hsa-mir-370 is one of the 10 miRNAs with aberrant expression that were selected based on potential pathways of interest and/or chromosomal location [PMC3679163]. It has been found that hsa-mir-370 could target CENPO expression in the LUAD [PMC10105544].

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GCCUGCUGGGGUGGAACCUGGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 14 other species

  1. Bos taurus bta-miR-370
  2. Canis lupus familiaris cfa-miR-370
  3. Cavia porcellus (domestic guinea pig) cpo-miR-370-3p
  4. Cervus elaphus (red deer) cel-miR-370
  5. Eptesicus fuscus efu-miR-370
  6. Equus caballus eca-miR-370
  7. Macaca mulatta mml-miR-370-3p
  8. Mus musculus mmu-miR-370-3p
  9. Oryctolagus cuniculus ocu-miR-370-3p
  10. Pan paniscus ppa-miR-370
  11. Pan troglodytes (chimpanzee) ptr-miR-370
  12. Pongo pygmaeus ppy-miR-370
  13. Rattus norvegicus (Norway rat) rno-miR-370-3p
  14. Sus scrofa (pig) ssc-miR-370
 Publications