Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) CASK antisense RNA 1 (CASK-AS1) URS000048FDBF_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

CASK-AS1: CASK-AS1, also known as GACAT2, is a long non-coding RNA (lncRNA) that may play a significant role in the screening and prognosis of head and neck squamous cell carcinoma (HNSCC) [PMC8116744]. Liu and Yu conducted an analysis of expression profiles of lncRNAs, miRNAs, and mRNAs to construct a competing endogenous RNA (ceRNA) network for laryngeal squamous cell carcinoma (LSCC), identifying five lncRNA biomarkers for LSCC, including TSPEAR-AS, CASK-AS1, MIR137HG, PART1, and LSAMP-AS1 [PMC7780331]. Kong et al also identified two lncRNAs (AC016773.1 and C00299) that may be involved in the progression of LSCC through a lncRNA-miRNA-mRNA network analysis [PMC7780331]. The subcellular localization of lncRNAs in the cytoplasm allows them to function as ceRNAs to regulate the expression of target mRNAs [PMC7780331]. The aberrant expression of TSPEAR-AS, CASK-AS1, MIR137HG, PART1, LSAMP-AS1 as well as miR-210 and mRNAs HOXC13, STC2 DIO1 FOXD4L were found to be associated with overall survival in LSCC patients [PMC6657684]. These findings suggest that the aberrant expression of these lncRNAs may have a significant effect on the prognosis of LSCC patients [PMC6657684]. In conclusion, CASK-AS1 is an important lncRNA involved in the screening and prognosis of HNSCC. Its dysregulation along with other identified biomarkers can provide valuable insights into the pathogenesis and overall survival of LSCC patients [PMC8116744] [PMC7780331] [PMC6657684].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAAGGUAACAGAAUCAUUGUUUAUUAUUAUUAAAAUAGAUUAUAGAAAGCAGCAUCUAUUUUGUGCAGUUUUUAGGGGCCUUGGAAAUAAAAAGCUAUGAUUUCCAAAAAUAUAACAUUCCAAAGGAUUGAAUAAUACAUACAUUUAAAGAUACAUUUUAUUAAAGUUUAGGAGAACUGAUUAAAAAAGAUACUGUCUCUUUAAAUUAGUGUGUAAUUGUUUUUCUCCUCCUAUCUAUUCGGACAUGACAAUAAUUAUAAAUGUAGGUCACACUACAACUAGGUAGUCUCUAGGGACCAUGACCUGCUGACACAAGGCCGAUAACAAAGAGACCUUUCCUGGGAGGCUGCUGGGAGGUCCAGGCAAGCCUCAGCUCUCUGGGUACAGCUCUCAAGAAAGGGGACUAGAAGUGAGAUAAAGAGACUUGCUUGAUUCUGUCCUGGCACUGCAGUGGGCAUGCGCAGACACCACAGCAGACAGGAACUCAAUCUUUUCUCUCAGGGCACUCUGAACCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications