Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-449c-5p URS00004838B1_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-449c: Mmu-mir-449c is an interacting microRNA that was determined using qPCR to verify the main conclusion drawn from microarray results [PMC6781998]. In the study, hub genes Enpp5, Fez1, Kif1a, F3, and H2-Q7 were identified along with transcription factors Pax8 and Hfs1 [PMC6781998]. These genes and their interacting microRNAs, including mmu-mir-449c, were found to be involved in age-related vascular dysfunctions [PMC6781998]. RT-PCR confirmed transcriptional alterations of Enpp5, Fez1, Kif1a, F3 and mmu-mir-449c in vascular aging [PMC6781998]. Mmu-mir-449c was listed as a common miRNA between networks built by turquoise and blue modules [PMC6781998]. The miRNAs including mmu-mir-449c were detected using qPCR [PMC6781998]. In a separate investigation comparing 6-month and 20-month old mice groups, RT-PCR confirmed the transcriptional alterations of Enpp5, Fez1, Kif1a and F3 along with mmu-miR-34c, mmu-miR-34b-5p, mmu-let7a as well as down-regulation of mmu-miR449a and mmu-mir449c in the 20-month old mice group compared to the 6-month old mice group [PMC6781998]. These hub genes along with Pax8 and Hfs1 exhibited the most connectivity with external lipid-related traits that could contribute to age-related vascular dysfunctions [PMC6781998]. [Reference: PMC6781998]

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGGCAGUGCAUUGCUAGCUGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Rattus norvegicus (Norway rat) rno-miR-449c-5p
Publications