Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-1291 URS000047E28E_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-miR-1291: Hsa-mir-1291, a human miRNA, has been found to be highly upregulated in asymptomatic patients, with a fold change (FC) of 14.6 [PMC8890551]. In addition to hsa-mir-1291, six other human miRNAs (hsa-miR-1246, hsa-miR-1248, hsa-miR-1274b, hsa-miR-1973, hsa-miR-4284, and hsa-miR-3656) have been accurately mapped to other non-coding RNAs (ncRNAs) such as snoRNAs, snRNAs, tRNAs, and rRNAs [PMC3102724]. These findings suggest that these miRNAs may have functional roles beyond their traditional roles in gene regulation.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGCCCUGACUGAAGACCAGCAGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

  1. Equus caballus eca-miR-1291a
  2. Pan troglodytes (chimpanzee) ptr-miR-1291
  3. Pongo pygmaeus (Bornean orangutan) ppy-miR-1291
Publications