Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-190a precursor URS00004719AB_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR190A: In a study, it has been observed that there are different miRNA expressions between GF and colonized animals, specifically involving the CREB and Ras/MAPK pathways, with a significant role of MIR190A in the MGB axis [PMC8615526]. The downregulation of miRNAs involved in extracellular matrix remodeling, including MIR190A, has been linked to the early onset of fibrosis in double-infected transplanted livers [PMC8869900]. MIR190A has been shown to facilitate bladder cancer invasion and autophagy by stabilizing ATG7 mRNA through binding to its 3′UTR [PMC8514698]. The binding of MIR190A to the 3′-UTR of ATG7 mRNA has also been demonstrated in humans [PMC7226452]. Plasmids targeting ATG7, HNRNPD, and MIR190A were used in experiments [PMC6468970]. Ectopic expression of MIR190A promoted invasion of UMUC3 cells, while control expression did not have an effect on invasion [PMC6468970]. The study provided evidence supporting MIR190A as a critical mediator for ATG7 mRNA stabilization in human bladder cancer cells [PMC6468970]. The activity of ATG7 3′-UTR luciferase reporter was significantly increased by ectopic expression of MIR190A and inhibited by antisense targeting MIR190A [PMC6468970]. HNRNPD and ARHGDIB expressions were consistently observed in tumors obtained from xenograft nude mice injected with UMUC3 cells expressing different constructs [PMC6468970]. The inhibition or induction of autophagy had an effect on HNRNPD and ARHGDIB expression in UMUC3 cells expressing ectopic or antisense forms of MIR190A [PMC6468970]. Deficiency of MIR190A expression increased PHLPP1 protein expression and impaired ATG7 protein expression [PMC6468970]. MIR190A has been found to promote bladder cancer invasion and autophagy by stabilizing ATG7 mRNA [PMC6468970]. The upregulation of MIR190A has been observed in human bladder cancer tissues [PMC6468970].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGCAGGCCUCUGUGUGAUAUGUUUGAUAUAUUAGGUUGUUAUUUAAUCCAACUAUAUAUCAAACAUAUUCCUACAGUGUCUUGCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 86 other species

  1. Ailuropoda melanoleuca microRNA 190a (ENSAMEG00000020740.2)
  2. Aotus nancymaae miRNA (ENSANAG00000002415.1, ENSANAG00000002454.1)
  3. Balaenoptera musculus (Blue whale) microRNA 190a (ENSBMSG00010001071.1)
  4. Bison bison bison miRNA (ENSBBBG00000012940.1)
  5. Bos grunniens (domestic yak) microRNA 190a (ENSBGRG00000004585.1)
  6. Bos indicus x Bos taurus miRNA (ENSBIXG00000020389.1, ENSBIXG00005020473.1)
  7. Bos mutus (wild yak) miRNA (ENSBMUG00000018480.1)
  8. Bos taurus microRNA bta-mir-190a precursor
  9. Callithrix jacchus cja-mir-190a (ENSCJAG00000030012.3)
  10. Camelus dromedarius microRNA 190a (ENSCDRG00005009148.1)
  11. Camelus ferus (Wild Bactrian camel) microRNA mir-190
  12. Canis lupus dingo microRNA 190a (ENSCAFG00020010648.1)
  13. Canis lupus familiaris microRNA cfa-mir-190a precursor
  14. Capra hircus microRNA mir-190a (ENSCHIG00000009491.1)
  15. Carlito syrichta (Philippine tarsier) microRNA 190a (ENSTSYG00000020628.2)
  16. Castor canadensis (American beaver) miRNA (ENSCCNG00000024231.1)
  17. Catagonus wagneri microRNA 190a (ENSCWAG00000000953.1)
  18. Cavia porcellus microRNA mir-190
  19. Cebus imitator microRNA 190a (ENSCCAG00000010965.1)
  20. Cercocebus atys (Sooty mangabey) microRNA 190a (ENSCATG00000017837.1)
  21. Cervus hanglu yarkandensis (Yarkand deer) microRNA 190a (ENSCHYG00000007693.1)
  22. Chlorocebus sabaeus (African green monkey) microRNA 190a (ENSCSAG00000022898.1)
  23. Choloepus hoffmanni microRNA 190a (ENSCHOG00000014617.1, ENSCHOG00000015474.1)
  24. Colobus angolensis palliatus (Angola colobus) miRNA (ENSCANG00000016596.1)
  25. Dasypus novemcinctus (nine-banded armadillo) microRNA 190a (ENSDNOG00000029119.1)
  26. Delphinapterus leucas microRNA 190a (ENSDLEG00000006257.1)
  27. Echinops telfairi microRNA 190a (ENSETEG00000020804.1)
  28. Equus asinus asinus miRNA (ENSEASG00005005826.1)
  29. Equus asinus (ass) microRNA 190a (ENSEASG00005005826.2)
  30. Equus caballus microRNA 190a (ENSECAG00000026492.2)
  31. Felis catus (domestic cat) microRNA 190a (ENSFCAG00000016672.3)
  32. Fukomys damarensis microRNA mir-190
  33. Gorilla gorilla gorilla ggo-mir-190a (ENSGGOG00000034616.2)
  34. Gorilla gorilla (western gorilla) microRNA ggo-mir-190a precursor
  35. Heterocephalus glaber microRNA 190a (ENSHGLG00000022365.2)
  36. Loxodonta africana microRNA 190a (ENSLAFG00000024917.1)
  37. Lynx canadensis microRNA 190a (ENSLCNG00005004658.1)
  38. Macaca fascicularis (Crab-eating macaque) microRNA 190a (ENSMFAG00000009101.2)
  39. Macaca mulatta microRNA mml-mir-190a precursor
  40. Macaca nemestrina microRNA 190a (ENSMNEG00000020575.1)
  41. Mandrillus leucophaeus (Drill) microRNA 190a (ENSMLEG00000013553.1)
  42. Marmota marmota marmota microRNA 190a (ENSMMMG00000010996.1)
  43. Microcebus murinus (gray mouse lemur) microRNA 190a (ENSMICG00000018517.3)
  44. Monodon monoceros (narwhal) microRNA 190a (ENSMMNG00015009842.1)
  45. Moschus moschiferus microRNA 190a (ENSMMSG00000015765.1)
  46. Mustela putorius furo miRNA (ENSMPUG00000023656.1)
  47. Neogale vison miRNA (ENSNVIG00000019166.1)
  48. Nomascus leucogenys (Northern white-cheeked gibbon) microRNA 190a (ENSNLEG00000019647.2)
  49. Ochotona princeps (American pika) microRNA 190a (ENSOPRG00000017708.1, ENSOPRG00000018936.1)
  50. Ornithorhynchus anatinus oan-mir-190a (ENSOANG00000016151.2)
  51. Oryctolagus cuniculus microRNA 190a (ENSOCUG00000018836.1)
  52. Otolemur garnettii (small-eared galago) microRNA 190a (ENSOGAG00000025791.1)
  53. Ovis aries miRNA (ENSOARG00000022111.1)
  54. Pan paniscus microRNA ppa-mir-190 precursor
  55. Panthera leo microRNA 190a (ENSPLOG00000016354.1)
  56. Panthera pardus (leopard) microRNA 190a (ENSPPRG00000014029.1)
  57. Panthera tigris altaica miRNA (ENSPTIG00000002554.1)
  58. Pan troglodytes microRNA ptr-mir-190a precursor
  59. Papio anubis microRNA 190a (ENSPANG00000039492.1, ENSPANG00000039584.1)
  60. Phocoena sinus (vaquita) microRNA 190a (ENSPSNG00000000930.1)
  61. Physeter catodon (sperm whale) microRNA 190a (ENSPCTG00005010503.1)
  62. Piliocolobus tephrosceles (Ugandan red Colobus) microRNA 190a (ENSPTEG00000031466.1)
  63. Pongo abelii microRNA 190a (ENSPPYG00000021898.2)
  64. Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-190a precursor
  65. Procavia capensis (cape rock hyrax) microRNA 190a (ENSPCAG00000019826.1)
  66. Prolemur simus (greater bamboo lemur) microRNA 190a (ENSPSMG00000006200.1)
  67. Propithecus coquereli (Coquerel's sifaka) microRNA 190a (ENSPCOG00000000457.1)
  68. Pteropus alecto microRNA mir-190
  69. Rhinopithecus bieti microRNA 190a (ENSRBIG00000022831.1)
  70. Rhinopithecus roxellana microRNA 190a (ENSRROG00000001327.1)
  71. Saimiri boliviensis boliviensis microRNA 190a (ENSSBOG00000009435.1)
  72. Sciurus vulgaris (Eurasian red squirrel) microRNA 190a (ENSSVLG00005018035.1)
  73. Sorex araneus microRNA 190a (ENSSARG00000015662.1)
  74. Spermophilus dauricus miRNA (ENSSDAG00000003952.1)
  75. Ictidomys tridecemlineatus microRNA mir-190
  76. Suricata suricatta (meerkat) microRNA 190a (ENSSSUG00005011124.1)
  77. Sus scrofa ssc-mir-190a (multiple genes)
  78. Theropithecus gelada microRNA 190a (ENSTGEG00000021175.1)
  79. Tupaia belangeri microRNA 190a (ENSTBEG00000017957.1)
  80. Tupaia chinensis microRNA mir-190
  81. Tursiops truncatus miRNA (ENSTTRG00000023567.1)
  82. Urocitellus parryii (Arctic ground squirrel) microRNA 190a (ENSUPAG00010020032.1)
  83. Ursus americanus (American black bear) miRNA (ENSUAMG00000012508.1)
  84. Ursus maritimus (Polar bear) miRNA (ENSUMAG00000024482.1)
  85. Ursus thibetanus thibetanus microRNA 190a (ENSUTTG00000009098.1)
  86. Vulpes vulpes (red fox) miRNA (ENSVVUG00000011259.1)
  87. Zalophus californianus (california sea lion) miRNA (ENSZCAG00015024593.1)
Publications