Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, C/D box 4A (SNORD4A) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, C/D box 4A (SNORD4A) URS000046CCFB_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD4A: SNORD4A is a small nucleolar RNA (snoRNA) that has been studied in various contexts [PMC9939161]. Risk models for different cohorts have been established using univariate and LASSO Cox regression analyses, and SNORD4A has been identified as one of the factors in the risk models [PMC9939161]. In exploratory analyses, SNORD4A showed lower mRNA levels in samples with crescents compared to those without [PMC6832959]. In a study using a 5xFAD mouse model, SNORD4A expression levels were significantly different in the brain cortex of 5xFAD mice compared to control mice [PMC9348914]. Additionally, significant hypomethylation of a CpG locus in the transcription start site (TSS) of SNORD4A was observed in a group with cerebral palsy compared to controls [PMC6539236]. SNORD4A is one of the non-coding RNAs (ncRNAs) expressed in various cell types, although its cell type specificity is still unknown [PMC7568261]. Furthermore, SNORD4A has been identified as one of the direct target genes of TP53 as a transcription factor gene [PMC6305651]. In another study, the abundance of SNORD4A did not vary between parent and KD cells regardless of changes in 2'-O-methylation levels [PMC8336889].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGUGCAGAUGAUGACACUGUAAAGCGACCAAAGUCUGAACAAAGUGAUUGGUACCUCGUUGUCUGAUGCACC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications