Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small NF90 (ILF3) associated RNA D (SNAR-D) secondary structure diagram

Homo sapiens (human) small NF90 (ILF3) associated RNA D (SNAR-D) URS000046AB44_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNAR-D: SNAR-D is a small non-coding RNA located on chromosome 19q13.33, which is a genomic region frequently gained in hepatocellular carcinoma (HCC) and non-tumor (NT) samples [PMC7863452]. SNAR-D is one of several small non-coding RNAs, including SNAR-A3, SNAR-B2, SNAR-H, SNAR-I, and SNAR-G2, that showed significant upregulation in GE2-HCC [PMC7863452]. Human and chimpanzee snaRs share sequence identity upstream and downstream of their genes, except for SNAR-D and -E [PMC2094060]. The genes for snaRs D, E, and F are located at varying distances outside the two clusters on chromosome 19 [PMC2094060]. Unlike other snaRs, SNAR-D does not share 5′-flanking sequence with other snaRs [PMC2094060]. The outliers in the snaR family include five unique genes on chromosome 19 as well as single copies on chromosomes 2 and 3 [PMC2094060]. In gene expression analysis of KNbO3 exposed series, the transcript for Small NF90 (ILF3) Associated RNA D (SNAR-D) was not found at the chosen level of expression [PMC9405746]. In addition to KNbO3 exposed series analysis results, several other transcripts were not recognized by Ensembl including FAM74A4, RNA28S5, SNAR-A3, SNAR-B2 and THC2526015 [PMC9405746].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCGGAGCCACUGUGGCUCCGGCUGGAUGCGCCUGCCCUCGGGCCCUCAGGGAGGCAGGGGUUCGAGGGUACGAGUUCAAGGCCAACCUGGUCCACAUGGGUUGAAAAAAAAAUUUUUUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications