Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, H/ACA box 60 (SNORA60) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, H/ACA box 60 (SNORA60) URS0000468B49_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORA60: SNORA60 is an H/ACA box snoRNA that has been found to be hypermethylated in gene promoters, along with other genes, such as PRPF3, PPP2R5A, and ANGEL2, which predicts a lower probability of BCR and is positively correlated with recurrence time [PMC8366102]. It has also been identified as one of the snoRFs that showed enrichment in response to radiation in the female CER [PMC9624364]. SNORA60 is one of the well-defined genes found in the GeneCards - Human Genes Database and has been associated with DLBCL [PMC9052811]. It has also been included in a prognostic risk model for DLBCL patients along with SNORD1A and SNORA66 [PMC9939161]. SNORD1A and SNORA60 have higher expression levels in DLBCL tissues compared to SNORA66 [PMC9939161]. Additionally, up-regulation of SNORD1A and SNORA60 correlated with an unfavorable outcome in DLBCL patients [PMC9939161]. Limited literature exists on the clinical value of SNORA60 in tumors [PMC9939161]. Functional analysis has shown that it is associated with positive regulation of cellular catabolic process and mRNA transport [PMC7355415]. Furthermore, reduced expression of SNORA60 has been observed in prostate cancer compared to normal expression levels, suggesting its potential as a biomarker for disease progression [PMC2923618].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CACCUGCAUUCAAAAAUGAUCACGGGCUGCCUGUGCUCUGGUCAUCAAUAACGCAGGGAGAGGAAUUGCUGAAAGCCGUUUCCCGUGUUUGGAGGGUUCACACCUGUCCCUUUCAAAUGCUGGCGCUUUCACACAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications