v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) prostate cancer associated transcript 4 (PCAT4) URS00004666D4_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

PCAT4: We assessed the prognostic significance of PCAT4, OCLN, CST2, miR-615-3p, and miR-148a-3p for various combinations of predictors, both with each other and with such clinicopathological parameters as ISUP and pT [PMC9916851]. The results of the calculations of the average change in the relative expression of the genes between the studied groups, performed based on the FFPE samples, showed the greatest decrease in expression in the presence of lymphatic dissemination for the PCAT4 gene (a 1.64-fold decrease) and the greatest increase in expression was shown for the CST2 gene (a 3.25-fold increase) [PMC9916851]. As a result of the filtering, the following genes were selected that best match the specified criteria: OCLN, F5, TBX1, CST2, RAB27A, PCAT4, and VGLL3 (Table 2) [PMC9916851]. As a result of the validation, we confirmed the statistical significance of the expression of the PCAT4, OCLN and CST2 genes in lymphatic dissemination in an independent sample [PMC9916851]. As a result of the validation of candidate markers by qPCR on an independent sample of patients, statistically significant results were confirmed for the PCAT4, OCLN, and CST2 genes, as well as miR-615-3p and miR-148a-3p [PMC9916851]. Statistically significant results were obtained based on the relative expression of the CST2, OCLN, and PCAT4 genes (Figure 3b and Table 3) [PMC9916851]. The PCAT4 (prostate cancer associated transcript 4; PCAN1; GDEP) gene is characterized by high tissue specificity for prostate tissue, but there are no published data on the biological function of this gene [PMC9916851]. PCAT4 was listed as one of the highly expressed genes in cluster 3 [PMC7073484]. PCAT4 was detected and located within consensus QTLs related to lipid metabolism processes in rapeseed [PMC6057442]. Finally, PCAT4 was identified as a shared gene between selected signatures from EBPSO related to prostate cancer [PMC9556859]. References: - PMC9916851 - PMC7073484 - PMC6057442 - PMC9556859

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AAAGUGAGAGAGGGAGGCAGAAGAGGAAGUCAGAGCGAUGUGCUGUGAAAUCUACUACCGUUUGCUGGUUUUGAAAAUGGAGAAAAAGAGUGAGGAACUGAGAAACAUGGAUGGCCUUGGGAACGUGGAAAAGGGUCACUGAAAUGGGACGACAUGAACUCAAGGAGGCUAUUUAUGACCAUGUCAUUUGCAACAUGAAGAAAGCUUAUCUGGAGUGAAAGUAAAUGAGACCAACAGAGAUGAGAGACCCGGAGAAAUCCUGGUUACACUGCUUGAAUCCUGUCAGUCCUAUACUGGAGUCCUGUUAAUACAAAAUAAUAGUAAUAAUCCCUCUGUUUCUUAUGUUUAUGCCAACUUCAACAAAAAGAAACUUGACUAAGAGACAAUAUAAGAAUUUAAUGUGUAAUUAAGAAAGAACUCUCCACCACGGGGAAUGUGAAAGGUAUAUGAGUCCCUUUUCACGAUGCGAUGUCAUGUCUUUUAAAUAAGCCAUACUUUAUGUUCAAUAAAAAGAGAAUAAGCAGGAUUCGCAAGAGAACACAAUCCCUUUUUAACUGCUGGGAAGAUACUUUUAGUCAUUAAUGACUGGACGACAAUUUGGGACACAUAUAUGGAUAUUGGCCGGUUUGUGAUGAUGUGAUUGGGCCUCUAAGUGACAACAUUGUUCCCUGUAUAGAGUGAGUGGCAAGUGCAUUUAUAAAAUUGGCCAUCAUGGCUGUUAAAUUUAUGAGUCUAGAAGUGUGCCUCUCAAACAAGUAUUUGAGAGGUUAUCAUGAAGAAAAACAAAAUUAAAAUUAUUCUGCUGAGCUCUCAAAGGCAGAACUAUUGAAUCAAAAUUAUAGGAAGGAAGGUUCAAACCAACAAUAAGAAUGCCUCUCUUGCAUUCCUCAUCACUAGAAGUUUCUGAUAAGAUUUUUAGAAAAAUUUAGACAGUAUUCUUGAAUUGAGCAGGGGGAUAACACAGAGAUAAUUCAAAUGUGGUUUGAUGAACUUCUAAAAUGGUUCCAACUAUAAACUUCAAUUAUUCUAGCCUCCAAGACCUACACAUAACUGUGCAAUGUGCAAAUUAUUCAAUAGUAACAUAGAAUUCUGAAUAAUUAGCAUUUUCUCAUGGUUUGAUAUUUGUAUAAAGCAAUCUUAGCAGUCUGAAUAACUAGAAUACUUCAAAGCAAUAUGUUUUAUUGCUUUAUAUUUAAAGAAACCAUGUCAGACAUUUAAAAUGAAUGGCUGCUAUCAGGAAAAUGGAUCUCAAGACACAAGAAAUAAAUCACAAUGACUUCCUUAUUUGUGGAAAUUCUUCUUGUACUAGAAAGGAAAAGUAGAAGUAUGGGAAAAUGUCUUCCAGAAAAUUACAUUUUCCCAAAGUUUAUUUUAAAUUUUAAUAAUUUAAUCAACCAUCUGAUUCUGAUUUCAAGUGUCACAGAAGUUCAUUUUAUUAUAAACAACAACAAAAAAACUUUGUAGUCUUGUAAACACUGGUGACAGAGAAUAACACCACUAACCAUGCUGAGCAGAAAACAGGAGCCAAGUAAGGGAAAAAGAUUCUUUAUGUCACUCAUCAAUUUAAAAGUGUUUUUCACCCCAGGACCAUCCUGAAGCCAAAACUGGGGAAACAUUUACUACUUUUACAAACAAAAAUUUAUAUUCCAUCCCUUGCAUGAUGUGUGUGUCUCCGACAUUUGGUUUCUGUCUUAAGUGUCUAAAGAAAGGCCUUAUUUAGAGCAAAAUACAUUUUUGUGGGCAUUGAUGUGAAUUUCAGGUCUGGGUUAUCAAUGACCUAAAUUGAGAAAAUAGAGGGGCUGUGUGGACAAGGAGAGAGAAGAGAGCAUACAGCUGCCCUAUGCCGUUGCUCUGUUCACAGUAAGGAUUGAGCCAUUCUAAUCCCCUUGGAUUUUUUAUCUACCAAAACAGCUUGGGCCCAUCAGCAAAUUGCAGUGGCAUAUGGUCCAGGUUUACGAGUAAUCUGGCACAUGAUUAAGGCAAGGGGGAUGUCAUCUUUCAGCAAAUACUGAAAAUAUUGUAGAAGAAUUUGGUAGAGUUUUUAAAUUCAAACUGAUAAAAUUGUAACUAUUAAAUACUUCCCCAAAUCAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications