Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, H/ACA box 75 (SNORA75) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, H/ACA box 75 (SNORA75) URS00004640CB_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORA75: SNORA75 is an RNA molecule that is targeted by miR-24, leading to mitochondrial dysfunction and growth inhibition in tumor cells [PMC8209332]. The binding of mouse SNORA75 to miRNA has also been analyzed [PMC8221328]. SNORA75 is a type of small nucleolar RNA (snoRNA) that plays a role in the modification of other RNA molecules, particularly ribosomal RNAs (rRNAs) [PMC8209332]. It has been found that the interaction between SNORA75 and miR-24 can disrupt mitochondrial function, which is crucial for cellular energy production and metabolism [PMC8209332]. This disruption can lead to growth inhibition in tumor cells, potentially providing a target for therapeutic interventions [PMC8209332]. The binding of mouse SNORA75 to miRNA suggests that this interaction may be conserved across species and could have important implications for understanding the role of snoRNAs in cellular processes [PMC8221328]. Further research is needed to fully elucidate the mechanisms by which SNORA75 and miR-24 interact and how this interaction contributes to mitochondrial dysfunction and growth inhibition in tumor cells.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUCUUCUCAUUGAGCUCCUUUCUGUCUAUCAGUGGCAGUUUAUGGAUUCGCACGAGAAGAAGAGAGAAUUCACAGAACUAGCAUUAUUUUACCUUCUGUCUUUACAGAGGUAUAUUUAGCUGUAUUGUGAGACAUUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

2D structure Publications