v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 313 (LINC00313) URS0000462C8A_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC00313: LINC00313 is a long non-coding RNA that has been implicated in various diseases [1]. One study found that LINC00313, which is up-regulated during Kaposi's sarcoma-associated herpesvirus reactivation, interacts with human immunodeficiency virus Tat to promote endothelial cell motility [2]. Another research team studying osteosarcoma found that patients with high LINC00313 expression had poorer overall and disease-free survival [3]. These findings suggest that LINC00313 may play a role in the progression and prognosis of different types of cancer. However, further research is needed to fully understand the mechanisms by which LINC00313 functions in these diseases. References: 1. [1] 2. [2] 3. [3]

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CUAGAGAGCUGGCGCACCUCCUGGGCCUGACGCGGGCUUCCUGGAUUGCAUAAAGGCUCCUUCUCCUUACAUAGCCAGGGCAAAGGUGCAUGACAACUCUGAGCAAGUCAAAACAACCGUCAGCAGCGGGAAACCUCGAUGAACAAACACCGGGAGAGUGUUUCUGCAGAUCCUGCUUUGUGACUUCGAGUGAAGUGUGGAAGCGCUGGAAGCACUUAGACCCUGCCUGUGCCGCAGACCCCUGGGAGGCACCAACACCCCGGAUCGAGAAGCCCGAUGGGAAAGAAUGUCUGGGAAGGACGUCAUGCCCGAGGCUUGCGUGACAGUUUCCACUCACAGUGCGCUCACUCUGAACCUCUGUGCACACGAUGGGCCUGCAUCUCUUCCCACUAUCUGCUAGGAAACACGAGGGGAAGGAAAUGACCGCAGAAGGGAGUGCACCGUGGGGGCAGGAGGUGCUGCGGCCAAUGGGCAGUGCUGGGAGAUGAAACCAACAGCGGCGAUUGCCCCAGAAAGAACUUGGCGCUGCUAAGGCAAUGGCGGCCCGAAAGAGGCCCCUGACGCAUGAGGAGCGGCCGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications