Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-889-3p URS000045B99E_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-889: Hsa-mir-889 is a microRNA that has been found to be significantly associated with overall survival in patients with ovarian cancer [PMC8148489]. It is one of the top 10 ranked miRNAs that have been identified to have a potential role in ovarian cancer [PMC8148489]. The survival analysis using Kaplan-Meir survival curves has confirmed the importance of hsa-mir-889 in ovarian cancer [PMC8148489]. Additionally, hsa-mir-889 has been found to be associated with the regulation of the HOXB7 gene, as it can bind to its binding sites [PMC8326182]. Furthermore, hsa-mir-889 has been identified as one of the 11 Down-DEmiRNAs that can predict gene expression regulation in prostate cancer [PMC8426106]. It has also been predicted to be a regulator of the VEGFA gene [PMC7444729]. Moreover, hsa-mir-889 has been shown to promote osteosarcoma proliferation by inhibiting myeloid cell nuclear differentiation antigen expression [PMC6854696]. In another study, it was found that hsa-mir-889 is one of the top ten significantly differentially expressed miRNAs in patients with chronic obstructive pulmonary disease (COPD) compared to healthy controls [PMC5759858].

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUAAUAUCGGACAACCAUUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 12 other species

  1. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-889
  2. Canis lupus familiaris (dog) Cfa-Mir-154-P27_3p (mature (guide))
  3. Cavia porcellus cpo-miR-889-3p
  4. Dasypus novemcinctus (nine-banded armadillo) dno-miR-889-3p
  5. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-154-P27_3p (mature (guide))
  6. Equus caballus eca-miR-889
  7. Macaca mulatta (Rhesus monkey) mml-miR-889-3p
  8. Oryctolagus cuniculus (rabbit) ocu-miR-889-3p
  9. Pan paniscus (pygmy chimpanzee) ppa-miR-889
  10. Pan troglodytes ptr-miR-889
  11. Pongo pygmaeus ppy-miR-889
  12. Pteropus alecto pal-miR-889-3p
Publications