v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Oryza sativa Japonica Group (Japanese rice) microRNA osa-miR166d-5p URS0000457229_39947

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GGAAUGUUGUCUGGCUCGAGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 14 other species

  1. Arabidopsis lyrata (lyrate rockcress) aly-miR166c-5p
  2. Brachypodium distachyon bdi-miR166e-5p
  3. Camelina sativa (false flax) cas-miR166a
  4. Citrus sinensis (sweet orange) csi-miR166a-5p
  5. Corchorus capsularis sRNA CCACVL1_13346
  6. Cynara cardunculus var. scolymus cca-miR166d
  7. Eugenia uniflora (Brazil-cherry) eun-miR166-5p
  8. Glycine max gma-miR166a-5p
  9. Medicago truncatula mtr-miR166g-5p
  10. Oryza sativa (Asian cultivated rice) osa-miR166d-5p
  11. Prunus persica (peach) microRNA miRNA_353
  12. Solanum tuberosum (potato) stu-miR166a-5p
  13. Vriesea carinata vca-miR166b-5p
  14. Zea mays (maize) zma-miR166c-5p