Homo sapiens (human) small nucleolar RNA, H/ACA box 71B (SNORA71B)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) small nucleolar RNA, H/ACA box 71B (SNORA71B) URS000045555D_9606

136 nucleotides
3 databases (GeneCards, HGNC, RefSeq)
Found in 0 other species
33 publications

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORA71B: SNORA71B is a small nucleolar RNA (snoRNA) that is induced by the upregulation of SNHG17 through miR-339-5p [PMC7245601]. The mechanism by which SNHG17 regulates the expression of SNORA71B has been investigated [PMC7245601]. Furthermore, the expression of SNORA71B has been found to have prognostic and diagnostic roles in breast cancer (BC) patients, as indicated by OS, PPS, and ROC curve analysis [PMC7567732].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

CCUGUAUUCGAAAGUGAUCGUGGGCUGCCUUUGCCCUGGUCAUUGAUAGUGCAGGGAGAGGAAUCAAUGAAAGCGCUUCCCCGUGUUUGAAGGGUCCACUCCUAUCCCUUCCAAACUCUGGAGCUUUCGUACAUGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure

Publications