Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, C/D box 25 (SNORD25) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, C/D box 25 (SNORD25) URS0000454FD5_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD25: SNORD25 is a small RNA that has been found to be significantly downregulated in a study analyzing gene expression during the differentiation of mesenchymal stem cells (MSC) [PMC5422944]. The study specifically focused on the expression of six small RNAs, including SNORD25, in samples taken during the differentiation of MSC passages 5 and 8 [PMC3121761]. The downregulation of SNORD25 suggests that it may play a role in the differentiation process of MSCs. Additionally, other genes such as PTCH2, ND6, and SNORD1 were also found to be significantly downregulated [PMC5422944]. These findings provide valuable insights into the molecular mechanisms involved in MSC differentiation and highlight the potential importance of SNORD25 in this process [PMC5422944]. Further research is needed to fully understand the specific role and mechanisms by which SNORD25 influences MSC differentiation [PMC5422944].

mRNA interactions 1 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUCCUAUGAUGAGGACCUUUUCACAGACCUGUACUGAGCUCCGUGAGGAUAAAUAACUCUGAGGAGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications