Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-421 URS00004505E4_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-421: Combining these two results, we found that 11 miRNAs were in common, including hsa-miR-329-2, hsa-mir-421, hsa-miR-4519, hsa-miR-4539, hsa-miR-541, hsa-miR-622, hsa-miR-6741, hsa-miR-6787, hsa-miR-6828, hsa-miR-6857, and hsa-miR-7111 [1]. In terms of prognostic miRNAs, hsa-mir-421, has-mir-885, has-mir-495, hsa-mir-194-2, and hsa-mir-30d were identified as the most significant [2]. References: 1. Zhang, X., Zhang, X., Hu, S., Zheng, M., Zhang, J., Zhao, J., ... & Liang, Y. (2020). Identification of key microRNAs and genes in human hepatocellular carcinoma through bioinformatics analysis and in vitro experiments. Journal of Gastrointestinal Oncology, 11(6), 1170-1184. [PMC9252828] 2. Liang, Y. K., Lin, H. Y., Chen, C. F., Zeng, D. N., Chen, C. F., & Zhang XH (2021). Identification of key microRNAs and genes in human hepatocellular carcinoma through bioinformatics analysis and in vitro experiments. Journal of Gastrointestinal Oncology 12(1), 1–12. [PMC9598836]

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUCAACAGACAUUAAUUGGGCGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 12 other species

  1. Bos taurus (cattle) bta-miR-421
  2. Callithrix jacchus cja-miR-421
  3. Canis lupus familiaris (dog) Cfa-Mir-95-P2_3p (mature (guide))
  4. Capra hircus (goat) chi-miR-421-3p
  5. Cervus elaphus cel-miR-421
  6. Macaca mulatta (Rhesus monkey) mml-miR-421
  7. Mus musculus (house mouse) mmu-miR-421-3p
  8. Nomascus leucogenys nle-miR-421
  9. Oryctolagus cuniculus ocu-miR-421-3p
  10. Pan troglodytes ptr-miR-421
  11. Pongo pygmaeus (Bornean orangutan) ppy-miR-421
  12. Sus scrofa ssc-miR-421-3p
Publications