Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) mitochondrially encoded 12S rRNA (MT-RNR1) secondary structure diagram

Homo sapiens (human) mitochondrially encoded 12S rRNA (MT-RNR1) URS000044DFF6_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MT-RNR1: MT-RNR1 is a gene that has been studied in relation to deafness in different ethnic populations. In a previous study, it was found that nine hotspot mutations, including those in MT-RNR1, were identified in 32.45% of Chinese Han deaf patients and only in 13.06% of Uyghur deaf patients, indicating a substantial difference in the mutation spectrum of common deafness genes between these two ethnicities [PMC4444116]. In another study, it was observed that the methylation levels of MT-TF and MT-RNR1 genes were significantly higher in steel workers with high exposure to PM1 compared to controls [PMC3660297]. Additionally, MT-RNR1 was found to be one of the mitochondrial genes along with MT-CO2 that were studied along with cell cycle genes (CDK6 and TFDP1) [PMC6173731]. These findings highlight the importance of studying MT-RNR1 and its association with different conditions such as deafness and exposure to environmental factors.

mRNA interactions 1 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAUAGGUUUGGUCCUAGCCUUUCUAUUAGCUCUUAGUAAGAUUACACAUGCAAGCAUCCCCGUUCCAGUGAGUUCACCCUCUAAAUCACCACGAUCAAAAGGAACAAGCAUCAAGCACGCAGCAAUGCAGCUCAAAACGCUUAGCCUAGCCACACCCCCACGGGAAACAGCAGUGAUUAACCUUUAGCAAUAAACGAAAGUUUAACUAAGCUAUACUAACCCCAGGGUUGGUCAAUUUCGUGCCAGCCACCGCGGUCACACGAUUAACCCAAGUCAAUAGAAGCCGGCGUAAAGAGUGUUUUAGAUCACCCCCUCCCCAAUAAAGCUAAAACUCACCUGAGUUGUAAAAAACUCCAGUUGACACAAAAUAGACUACGAAAGUGGCUUUAACAUAUCUGAACACACAAUAGCUAAGACCCAAACUGGGAUUAGAUACCCCACUAUGCUUAGCCCUAAACCUCAACAGUUAAAUCAACAAAACUGCUCGCCAGAACACUACGAGCCACAGCUUAAAACUCAAAGGACCUGGCGGUGCUUCAUAUCCCUCUAGAGGAGCCUGUUCUGUAAUCGAUAAACCCCGAUCAACCUCACCACCUCUUGCUCAGCCUAUAUACCGCCAUCUUCAGCAAACCCUGAUGAAGGCUACAAAGUAAGCGCAAGUACCCACGUAAAGACGUUAGGUCAAGGUGUAGCCCAUGAGGUGGCAAGAAAUGGGCUACAUUUUCUACCCCAGAAAACUACGAUAGCCCUUAUGAAACUUAAGGGUCGAAGGUGGAUUUAGCAGUAAACUAAGAGUAGAGUGCUUAGUUGAACAGGGCCCUGAAGCGCGUACACACCGCCCGUCACCCUCCUCAAGUAUACUUCAAAGGACAUUUAACUAAAACCCCUACGCAUUUAUAUAGAGGAGACAAGUCGUAACAUGGUAAGUGUACUGGAAAGUGCACUUGGACGAAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications