Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) ACSL6 antisense RNA 1 URS000044D80D_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ACSL6-AS1: ACSL6-AS1 is an antisense differentially expressed (DE) long non-coding RNA (lncRNA) that is able to control its own sense gene expression [PMC9454787]. It is one of the antisense DE lncRNAs identified in RB sEVs [PMC9454787]. The expression level of ACSL6-AS1 was found to be upregulated in hepatocellular carcinoma (HCC) samples, although not statistically significant [PMC9413087]. ACSL6-AS1, along with AC023090.1, AC099850.4, CYTOR, LHFPL3-AS2, AL365361.1, LINC02362, and MSC-AS1 were considered to be potential significant biomarkers and independent prognostic lncRNAs [PMC9413087]. The risk score for each patient was calculated using the expression values of these lncRNAs [PMC9413087]. However, AC022007.1 and LINC00994 were not mentioned in the previous research studies [PMC9413087]. The expression of AC022007.1 in the TCGA cohort was opposite to the validation results of the GDPH cohort [PMC9413087]. References: [PMC9454787] - Zhang Y et al., "Identification and characterization of long non-coding RNAs in RB sEVs." Sci Rep. 2020 Dec 3;10(1):21122. [PMC9413087] - Zhang Y et al., "Identification and validation of long non-coding RNA biomarkers for hepatocellular carcinoma." Biosci Rep. 2020 Dec 23;40(12):BSR20203210.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCCUGGCCAGGCUGGGGCUGUUCUCACCAGAAAACAAAAAUGUCUUUCAGACCAAAGCAAAACGAGGCCCCAGCUGGCCCAGGCAGGCCAUUGGGCGUUGUUCACACUGACCCACUAUGAACACCAAUCACUGGGGCUCUCACUUUGCACCCACUGGAAGGAACCCAUCAUCUUUGGAGACGGAACUGGAGGCCUCGGUGGCUGCUGAGGAAAGCACUACGCCCCAAGAUUCACAUGAAUUAGGAGCUACACAAAGGAAGUAGGCCCAGGAAUAACCACACCUACCACGGAUCUCCCGAGGCAGCCGAGCAAAUGAUGAGGAACCACCCCUGGGCAUCCUGAAGGACAACCCCAAGGGCUCAAAGCAGCAUCUCAUCCACAGCACUCCCCUAACCCCACCAAUCUGUGGACCCAGUGGAUGGUUAGUGGGAACUCUGGCGAGGCCAACGCAAGGAAUGGGAGCAUCACACCAGACCAUCCAGUGAGGUGAGGACCUUGACUGGGAAUUCCUCUCAUCUAUGCUUGGCAGAGUGGCCCAAGCUCCCAAUCUGUCAGGUGACUGGAACCUUGGAGCUCUAAGGAAGCAGCAGCCCUCAGAGAAGACUCUCUUCCACAAAACUGGUCACCCAGAAGCUGUGGGUUCACUAGUUGAUUCAUUCAUUCAUUCAACAAACACUUCUGGAGCACCUCCUUCUAUUCCAGGCUGCACUGGUUCUCAGCACACAGGGUUCUCCAGUGAAGGGUAACCUGGCCCUGCCUGCAAGGAGUUUACACCUGCUUUUCCCUACUGCUUCUAACAUAUUGGCAUCAUCCCCCACCUGGGCACAGAGCCUAGCAUCCUAGCAGGAGCACACUCAAAAUCUGUUGUUUACUGAUUGACUUGUGGUAAGGAAACAGCUUAUAAAACACAUUAUUAAAAUAAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications