v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) CACNA1C antisense RNA 3 (CACNA1C-AS3) URS000044232A_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

CACNA1C-AS3: CACNA1C-AS3 is a long non-coding RNA (lncRNA) that is associated with calcium channel-related transcripts. Knockdown of FHL1, a protein-coding gene, resulted in lower levels of CACNA1C-AS3, along with other calcium channel-related transcripts [PMC6534093]. Mutational analysis of CACNA1C-AS3 revealed that it had mutations in 7 samples and was significantly associated with survival in STAD (stomach adenocarcinoma) [PMC6745513]. The mutated samples had shorter survival compared to non-mutated samples [PMC6745513]. Mutations in CACNA1C-AS3 also had significant effects on the predicted secondary structures of the lncRNA, which subsequently impacted its expression [PMC6745513]. Additionally, CACNA1C-AS3 was found to co-occur with other MutLncs (mutated lncRNAs), such as HOTAIRM1, which is located between the HOXA1 and HOXA2 genes [PMC6745513]. These findings suggest that CACNA1C-AS3 plays a role in calcium channel regulation and may have implications for survival in STAD. Further research is needed to fully understand the functional significance of CACNA1C-AS3 mutations and their impact on lncRNA expression and secondary structures.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AACUCCCAGAUGCCAUAAGGUUGAUUUUUCAGUGACCCUUCAGAAGGCCAGUCCCUUUGGCUCCUACGUGGCACUACAGGUUCCAUACACCUGGGAUGCUGAGGCCAAGCCAGAGCUUCUCGGAGUCUCGGGCUACGGCUUUUCCCUAGUGCAAUGGAGACAGCAGGAGACAGGUCCCUAAGCAAGAUGCCUGGAUGGUUUUUGGAGCUGUCCAUCCUACCCAGGUGGGGCUCAUUAACCAUACCACCUUGGUGAGCAGCUAUGGAGCACAUCCUAACCCUCACGGGCUAACUACCUGAGAUAGCCUCUCAAGCUUUUGGAGAGCCUCAUACUUGUCUUGGGACCUAAACAAUGAAUGACAGGCCAGCAAGCGCUGAUUUCAUGCUUUGUGUGGUCAGGAUGAUGUGCUCAAGGGGCUGGUGGAAAGAUCCGAUUUCUCUGGUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications