v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) telomerase RNA component secondary structure diagram

Homo sapiens (human) telomerase RNA component URS00004416C5_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

TERC: TERC is an RNA subunit of telomerase and is targeted by the oligonucleotide inhibitor Imetelstat [PMC4977715]. Imetelstat is a lipidated 13mer thiophosphoramidic acid oligonucleotide that competitively inhibits telomerase activity and suppresses cancer cell viability [PMC9325578] [PMC10044978]. PARN, an RNase, is responsible for TERC deadenylation and prevents degradation [PMC9586155]. PARN is a 3′–5′ exoribonuclease that has functions in mRNA turnover and the maturation of non-coding RNAs, including TERC [PMC6952385] [PMC9458449]. Imetelstat disrupts telomerase ribonucleoprotein assembly by binding to the TERC template, inhibiting telomerase activity at telomeres [PMC4929421]. Loss of GDF11 in vitro causes shortening of telomere length, downregulation of TERT and TERC, and reduction of telomerase activity [PMC8473905]. SRSF11 binds to TERT through TERC, as verified by experiments with telomerase-negative cells [PMC4787792]. PNPASE is involved in trafficking TERC into mitochondria where it is processed to TERC-53 by RNASET2 [PMC6711880]. HuB and HuD associate with TERC and repress telomere activity, while HuR promotes it through promoting methylation of C106 in TERC [PMC7969021]

mRNA interactions 15 total

Targeting miRNAs 27 total

According to LncBase, this RNA is targeted by the following miRNAs:

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GGGUUGCGGAGGGUGGGCCUGGGAGGGGUGGUGGCCAUUUUUUGUCUAACCCUAACUGAGAAGGGCGUAGGCGCCGUGCUUUUGCUCCCCGCGCGCUGUUUUUCUCGCUGACUUUCAGCGGGCGGAAAAGCCUCGGCCUGCCGCCUUCCACCGUUCAUUCUAGAGCAAACAAAAAAUGUCAGCUGCUGGCCCGUUCGCCCCUCCCGGGGACCUGCGGCGGGUCGCCUGCCCAGCCCCCGAACCCCGCCUGGAGGCCGCGGUCGGCCCGGGGCUUCUCCGGAGGCACCCACUGCCACCGCGAAGAGUUGGGCUCUGUCAGCCGCGGGUCUCUCGGGGGCGAGGGCGAGGUUCAGGCCUUUCAGGCCGCAGGAAGAGGAACGGAGCGAGUCCCCGCGCGCGGCGCGAUUCCCUGAGCUGUGGGACGUGCACCCAGGACUCGGCUCACACAUGCAGUUCGCUUUCCUGUUGGUGGGGGGAACGCCGAUCGUGCGCAUCCGUCACCCCUCGCCGGCAAUGGGGGCUUGUGAACCCCCAAACCUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications