Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-30a precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-30a precursor URS000043D261_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR30A: MIR30A is a type of microRNA that plays a role in various cellular processes [PMC6888542]. Targeting MIR30A has been shown to decrease autophagy and increase sensitivity to Imatinib in primary LMC cells [PMC6888542]. The human MIR30A loop sequence (MIR30Ahsp) has been chosen for its high expression of siRNAs [PMC2737240]. Inhibition of exosomal MIR30A has been found to attenuate the protective effect of EGCG in hypoxic injury [PMC7054242]. The miR-30 family members, including MIR30A, are encoded on different chromosomes in clustered pairs [PMC4873751]. In a study, the expression of various genes was found to be affected by MIR30A, including both upregulated and downregulated genes [PMC7260613]. Specifically, miR7b and MIR30A were found to target the unique OCs-specific fusogen DC-STAMP [PMC7504439].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCGACUGUAAACAUCCUCGACUGGAAGCUGUGAAGCCACAGAUGGGCUUUCAGUCGGAUGUUUGCAGCUGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 22 other species

2D structure Publications