Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, H/ACA box 48 (SNORA48) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, H/ACA box 48 (SNORA48) URS0000438819_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORA48: SNORA48 is a small nucleolar RNA (snoRNA) that is widely present in various cell lines and tissues [PMC5669939]. It belongs to the H/ACA family of snoRNAs and is involved in guiding the 2'-O-methylation of target RNA [PMC5793181]. SNORA48 has been found to be differentially expressed in different grades of meningiomas, with higher expression levels in grade I tumors compared to grade II/III tumors [PMC8797451]. It has also been identified as a potential tumor progression suppressor in meningiomas [PMC6489307]. SNORA48 is predicted to guide the pseudouridylation of 28S ribosomal RNA during ribosomal subunit biogenesis [PMC8240307]. It has been found to be downregulated in old equine cartilage and old DMM mouse serum, suggesting a potential role in aging-related processes [PMC5333149]. SNORA48 is located within the intron of Eif4a1 gene, which is involved in ribosome biogenesis and translation initiation [PMC8240307]. Overall, SNORA48 plays important roles in various cellular processes and its dysregulation may have implications for disease progression and aging.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGUCCCUGACCUGGGUAGAGUGGCAUCUGGUUGGUGAUGCCCAUCUCAUAUCAGCCAGGGACAAAGCAACUCCUUGUUCAUCCCAGCUUGGCUUUUGAUCCGUGCCCAUGCCUGGUUCAUGCCUUGGACACAUAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

2D structure Publications