Homo sapiens (human) ACVR2B antisense RNA 1 (ACVR2B-AS1)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) ACVR2B antisense RNA 1 (ACVR2B-AS1) URS00004374A2_9606

2,517 nucleotides
11 databases (ENA, Ensembl, Ensembl/GENCODE, Expression Atlas, GeneCards, HGNC, LncBook, LNCipedia, MalaCards, NONCODE, RefSeq)
Found in 0 other species
21 publications
1. lncRNA
2. antisense lncRNA

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ACVR2B-AS1: ACVR2B-AS1 is a long non-coding RNA (lncRNA) that has been studied in breast cancer patients, and high expression of ACVR2B-AS1, along with other lncRNAs such as WEE2-AS1, LINC-PINT, and HAND2-AS1, has been associated with favorable disease-free survival (DFS) in breast cancer patients [PMC6376750]. A risk score was calculated using the expression levels of ACVR2B-AS1 and other lncRNAs to assess the potential impact of these lncRNAs on breast cancer [PMC9922719]. The functional implication of this signature was explored by examining the expression correlation between these lncRNAs and mRNAs, and co-expressed mRNAs were selected based on this analysis [PMC9922719]. However, the diagnostic accuracy of ACVR2B-AS1 alone was found to be insignificant based on the results of an AUC analysis [PMC6925724]. This suggests that ACVR2B-AS1 may not be a reliable diagnostic parameter on its own. Further research is needed to better understand the role and potential clinical implications of ACVR2B-AS1 in breast cancer.

Targeting miRNAs 10 total

According to LncBase, this RNA is targeted by the following miRNAs:

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

GCUACACUUAGUGACUCUGAGGGACAUGCAACCCUCCCCGCAUGCUGCUGCUGCUGCUGCACCUACAAUCCUGCCACCCCCAAUGAGAUCUGCCCACCCCUCUUGGCCGCCUUCCCCACGCUCAGGUUUUCCUCACUCUUUCCCUGGGUUCCACGCGCCCGCGUAGCCCGAACUCCGACCCUGAGGCUCCGCGUCCCGGCCCCCAUCGCAGGGGCGCCUCUAGGAACCAGAAUCCCGCAGAUGACUGCACAGACAAGAUCGUGCCCCCAAGUUCGGCGAGCCGGGCGCCCACCGCGCCCCCAGCCCACGCCCCCGGAGUUCCUGCGCCACCCACAGCGGCCCUGAGCUUCAAUCUGCACUUUCAAAACUUCCCAGUUGCCUCCAGAGCCCUGCAGUUGAAGAUCUUGUCUAGCACAUGGUUUUGCUGUUUUCCUCACCCCGAACUCCCUCCUUGGAGGGCCAUCGUUCUCUGUCUCAGAUUCCACCCUCCUUAUCACACAACUAGAGCUUCGGAGGAACGUGAUGGGGCUCCCAACUAAGGAGGGAAAGACCAUCAUAGCUCAGGGAUGAGGCUCCGAGAUCCUCAGAUAACAUUAAUUGUCCUCUGUCUUCUCUUGACUUGGCACAUCCUUGCUUGGAGCAGGGCAGGAGCAGCUGAAAGGGAGGUGGCACCUGGAGGUCUCAGUCAUUUCACUUCUCUGAGCCUCAGUUUUCCCAUAUGCAAAGUGAAGAGGUACACUCCCUCAGGGUUUUGCAUCUUCUUAAUGGCAGAAACCUAGUCAAACAAAAUAUUAUGUAAAUGUUCACUAUAGGCAGGGCGAGGUGGCUCAAACCUGUAAUUCCAGCACUUUUAGAGGCCCAGGAGGCUCUUGAGGUCAGGAGUUCGAGACCAGCCUGACCAACAUGGCAAAAACCUGUCUCUACUAAAUAAUACAAAAAUUAGCUGGGCAUGGUGACACACACCUGUAAUUCCAACUACUCGGUAGGAGGCUGAGGCAGGAGAAUCGCUUGAACACAGGAGGGAGGCGGAGGUUGCAGUGAGCUGAGAUUGCACCACUGCACUCCAUCCUAGGUGACAGAGUGAGACUCUCUCUCAAAAAAAAAACAAGUUUAUAAAGGAAUGUAUAUUGUUCUGAUUGACAUUGAAAUAGGGUCAACUACCCCCGGUCACCAGAGCAGCAGGAACACCUCAGGGGCCACACUUUGGAGGCACUGCCCAGAAAGAUUUCUGGGUCUUUAAAAGUCCCUUCCAGUCCUGGGAAAUUCUAUGUGAAAAUGAUGGUCCCUGCUUGCUAUAAUCCCUACAGGUGACUUAUUAUCUAAGCCAUUUAACACAGGAUUGAAUACUAUGCGACUGUGUGCCAAGCAAGAAGCAGUGUUGUAUGGGACACCCUAGCUGUGUAUAAGGUAUCUGGUAAUAACACAGGAGGCCACAGUGAUAGACUGUGAUAACGGAAGUAAUUCCAUAUCCAGUUUAAGUGUCUUUUCUAGGGAGUAUAAAUCGUUAUCUCCAUUCCAAUAUGGACUGAAAGGUAUCGACUUUUAUCCAUGUGCCAAAAAUUAGAUUGGCUGGUUCCUCUCUUCUACUCCAUACCAGGUCAGGUAUCAUAAUAAGGACUCAGAGUGGUCCAAGCUGCCCAAAUAUCUGUGUCUUCCACUCUGACCUGUCUGGGAACCCCAAAUUUAUAUCCAACUGCUUACUUGACAACUGCAGUUGGUAGCCUAUCAGGCAUCUCAAAUUUGACCUAGCCAAAGCAGAAGUCCUCAUUUUCCCCGUAAAUCUCCUCCCCAGUUUUCCCUGUCUGAAUCAAUGGCAUAAGCAACUACACCAUUGCUCAAAUCAGAACCUUAUGAGUCCUACUGAAACCAGCCAAAGAGUCCCAUAGACAGUUGUUUUUGUUUUUGUUUUUGUUUUUGUUUUUGAGACAGAGUUUGGCUCUUAUUGCCCUCACUGGAGUGCAGUGGCACGAUCUCGGCUCACUGCGACCUCCACCUCCUGAGUUCAAGUGAUUCUCCUGCCGCAGCCUCCCAAGUAGCUGGAAUUACAGGCACGCCACCAUGCCCAGCUAAGUUUUGUAUUUUUAGUAGAUACAGGGUUUCAUCAUGUUGGCCAGGCUGGUCUUGAACUCCCAACUUCAGGUGACCUGCCUGCCUCAGCCUCCCAAAGUGCUGGGAUUAUAGAAGUUGACCCUUUUGCAGUUAAAGCUGGAAACUUACUUGUUUUAUCCGAGUUCCUUCCUCAGGAAAGGACCUUCAGGCCUCUCACAAAAAGUAUCAAAGAACUGAAGCCAUAAAAAGUAUCAAAAGAACUGAAACCAGAUCACUGCACUAGAUGCUGGGCCCCUCAGUCACCAUGAUUGCUUCCUUGCCCCUCCCAUGUUCCUGUUUUCUUACAUAUUGUUACAUUUCUUUCCUGCUAUAUAAACCCUUGGUUUUGGUCAGUCAAGGAGAUGGAUUUGAGACUGCACUCCCAUCUCCUUGGCUGCAGCACCUGAUUAAAGCCUUCUUCCUUGGCAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Expression New

Publications