Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) small nucleolar RNA, C/D box 15B (SNORD15B) URS000043549A_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD15B: SNORD15B, a small nucleolar RNA, has been found to upregulate both TRIM25 expression and activity in endometrial cancer cells [PMC9529403]. Additionally, high expression of SNORD15B or SNORA5C in colorectal cancer (CRC) tissues has been shown to independently predict a poor prognosis [PMC9110153]. These findings suggest that SNORD15B plays a role in the progression and prognosis of both endometrial and colorectal cancer. The upregulation of TRIM25 by SNORD15B in endometrial cancer cells indicates that SNORD15B may contribute to the activation of the TRIM25 pathway, which is involved in various cellular processes including immune response and antiviral defense [PMC9529403]. This suggests that SNORD15B may have a role in promoting tumor growth and progression. In CRC tissues, high expression levels of both SNORD15B and SNORA5C have been associated with poor prognosis [PMC9110153]. This suggests that these small nucleolar RNAs may serve as potential biomarkers for predicting the outcome of CRC patients. The independent predictive value of these RNA molecules indicates their potential as prognostic markers for CRC. In conclusion, SNORD15B is involved in regulating TRIM25 expression and activity in endometrial cancer cells [PMC9529403], while high expression levels of both SNORD15B and SNORA5C are associated with poor prognosis in CRC patients [PMC9110153]. These findings highlight the potential significance of these small nucleolar RNAs as therapeutic targets or prognostic markers for endometrial and colorectal cancer.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUUCAGUGAUGACACGAUGACGAGUCAGAAAGGUCACGUCCUGCUCUUGGUCCUUGUCAGUGCCAUGUUCUGUGGUGCUGUGCACGAGUUCCUUUGGCAGAAGUGUCCUAUUUAUUGAUCGAUUUAGAGGCAUUUGUCUGAGAAGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

Publications