Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-147-3p URS0000424278_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-147: Mmu-mir-147 is a type of microRNA that is located in exon 4 of the normal mucosa esophagus specific 1 (NMES1) transcript. It shares the same mature sequence as mmu-mir-147b and is located in a similar position on the mouse homologous gene [PMC3441733]. Mmu-mir-147 has been shown to be induced upon Toll-like receptor (TLR) stimulation in murine macrophages and is involved in the regulation of the inflammatory response, potentially acting as a negative feedback loop of the TLR pathway [PMC3441733]. It has also been found to be activated during the inflammatory response in mice, where it functions as a negative regulator of TLR-associated signaling events [PMC4077261]. In a study using TaqMan qRT-PCR, A549 cells were treated with LPS and TNFα under normoxic or hypoxic conditions to measure the levels of three mature miRNAs, including mmu-mir-147 [PMC3441733]. Small RNA reads for mmu-mir-147 were found along with two other exonic miRNAs (mmu-miR-21 and mmu-miR-671) [PMC2736397]. Additionally, miR-142 was observed in relation to understanding Chlamydia pathogenesis using miRNAs [PMC6379932]. MiR-147b levels were below detection limits in these cells, and miR-298 does not exist in humans [PMC7192443].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUGUGCGGAAAUGCUUCUGCUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 16 other species

Publications