Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-378a-3p URS0000420D03_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-378a: mmu-mir-378a is a microRNA that has been found to undergo low editing at embryonic day 11.5, but its editing efficiency increases during development in the adult brain [PMC4231736]. Surprisingly, mmu-mir-378a is highly abundant in the brain, despite not being reported as highly expressed in the nervous system [PMC4231736]. mmu-mir-378a has been reported to be edited by others as well [PMC4231736]. In a study analyzing a group of miRNAs, mmu-mir-378a was found to be the most abundant member [PMC4231736]. In cultured adipocytes, the expression of mmu-mir-378a is dependent on PPARĪ³ or its ligand rosiglitazone [PMC4709675]. Additionally, mmu-mir-378a is upregulated during osteoclastogenesis in vitro [PMC4709675]. The natural occurring sequence of mmu-mir-378a was predicted to target mCYP1A2 at two positions within its coding sequence [PMC7844233]. The sequence of mmu-mir-378a was obtained from the miRbase database and its target prediction was performed using the miRWalk Version 3 database that combines data from multiple prediction algorithms [PMC7844233]. In an experimental procedure involving systemic administration of naked DNA, the mouse protein-coding sequence of Yin Yang 1 (p-YY1) and mmu-mir-378a precursor sequence (miR-378a) were amplified and cloned into vectors for further analysis [PMC7889173].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACUGGACUUGGAGUCAGAAGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

  1. Equus caballus eca-miR-378
  2. Macaca mulatta mml-miR-378a
  3. Pan troglodytes ptr-miR-378a
  4. Rattus norvegicus (Norway rat) rno-miR-378a-3p
Publications