Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-940 URS000041FA2C_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-940: Hsa-mir-940, a type of exosomal microRNA, has been extensively studied in relation to prostate cancer (PCa) and gastric cancer (GC) [PMC8129505] [PMC6111604]. Exosomal hsa-mir-940 secreted by PCa cells has been found to induce the transformation of bone marrow mesenchymal stem cells into an osteoblast phenotype in the bone metastasis microenvironment [PMC8129505]. This transformation is mediated through the targeting of ARHGAP1 and FAM134A by the exosomes [PMC8129505]. Ultimately, this process promotes bone metastasis of PCa [PMC8129505]. Additionally, hsa-mir-940 upregulation has been observed in GC tumor tissues and PC salivary samples [PMC6111604]. These findings suggest that hsa-mir-940 may play a role in both PCa and GC, although its specific functions may vary between these two types of cancer. Further research is necessary to fully comprehend the mechanisms by which hsa-mir-940 contributes to tumor progression in these contexts [PMC8129505] [PMC6111604].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAGGCAGGGCCCCCGCUCCCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

  1. Gorilla gorilla gorilla ggo-miR-940 (MIR940)
  2. Gorilla gorilla ggo-miR-940
  3. Macaca mulatta (Rhesus monkey) mml-miR-940
  4. Pan troglodytes (chimpanzee) ptr-miR-940
Publications