Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-15b precursor URS000041CB9C_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-15b: Hsa-mir-15b is a microRNA that has been studied in relation to its expression in CD34+ HSCs [PMC4669904]. One study found that the expression of Sall4, a transcription factor, was inversely correlated with the expression of hsa-mir-15b and hsa-miR-219-5p in CD34+ HSCs [PMC4669904]. Another study evaluated the performance of different miRNAs as potential biomarkers and found that hsa-mir-15b had an area under the ROC curve (AUROC) of 0.726 [PMC9279521]. The AUROC is a measure of how well a biomarker can distinguish between different groups, with values closer to 1 indicating better performance [PMC9279521]. The study also reported AUROC values for other miRNAs, such as hsa-mir-200c (0.784), hsa-mir-141 (0.894), and hsa-mir-16-2 (0.752) [PMC9279521]. These findings suggest that hsa-mir-15b may play a role in regulating gene expression in CD34+ HSCs and could potentially be used as a biomarker for certain conditions or diseases [PMC4669904] [PMC9279521]. However, further research is needed to fully understand its function and potential clinical applications [PMC4669904] [PMC9279521].

MIR15B: MIR15B is a microRNA that has been studied in the context of aerobic exercise and apoptosis regulation. One study found that MIR15B expression decreased after 6 weeks of aerobic exercise [PMC9811960]. Additionally, MIR15B, along with miR100, miR101, miR20a, miR92a, and miR132, is involved in priming apoptosis by targeting inhibitors of the intrinsic apoptosis pathway [PMC7123062]. MiR101 specifically regulates the formation of Rab1a [PMC7123062]. These findings suggest that MIR15B plays a role in both exercise-induced changes and apoptosis regulation.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUGAGGCCUUAAAGUACUGUAGCAGCACAUCAUGGUUUACAUGCUACAGUCAAGAUGCGAAUCAUUAUUUGCUGCUCUAGAAAUUUAAGGAAAUUCAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications