Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) HLA-DQB1 antisense RNA 1 (HLA-DQB1-AS1) URS0000412E4B_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

HLA-DQB1-AS1: HLA-DQB1-AS1, an immune-related long non-coding RNA (lncRNA), has been identified as a significant prognostic marker in hepatocellular carcinoma (HCC) [PMC7273488]. Previous research has demonstrated that HLA-DQB1-AS1 is associated with susceptibility to HCC [PMC9117035]. Further investigation of HLA-DQB1-AS1 was conducted due to its high expression in MHCC97-H and Huh-7 cells [PMC9117035]. Additionally, a study focusing on low-risk patients revealed that HLA-DQB1-AS1 is a protective factor [PMC8238568]. These findings emphasize the crucial role of HLA-DQB1-AS1 in the immune response and its potential as a prognostic marker and therapeutic target for HCC [PMC7273488][PMC9117035][PMC8238568].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UACAGAUAACUCAGGAUCAUGUUUAAUUAUGUAAAAAAGCUCUAAAGUCAGGUAAUGUUUUUCAUGUGCUUCUCUUGAGCAGUCUGAGGAAAGAAUAGAAACAGAAACCCCUUGGGACCUGAGUAGACGCAGCUGGCCAUGCACAGGCAGAGGCUCUGGGUCAGUGCAGGAAGCAGAGUCCAGGGUGUAUUGUCAUCACCUCCCCCAAGAUCUGUGCAAAGGUGAAAUCAGCUCAUGAGGACACAGAACUUCAGCUUGAUGCAGAUGUGUGGGAGGUGGGGAACAGCUGUUAUUCUUCUGGGGAAUAUGAAGGGUUCAGUCUUUUUAGGAAAUUGGAUGAUAUCUCUUCCCGACCACUAGCAGCCUCUUUCAGUCACUGGAAAAUGCUUACAGGCAGUAGCCACCAUCAUGUGGCACAAAGUGGGCAUCAUCCUAGUGUCUAACAUUUAAGCUGUGGUUCUGGCUCCACAUUUCACAAGAAGAUGCCACCAAAGUUAAGGCUUGGUUCUGGGGAACAAUGUCUGGAGAUUCCUAGAAACUGGCAAACUUCUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications