Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-4772-5p URS0000411752_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-4772: Hsa-mir-4772 is a miRNA that has been identified as part of a five-miRNA signature in a study on survival risk score in cancer patients [PMC5955976]. However, the downregulation of hsa-mir-4772 in pancreatic ductal adenocarcinoma (PDAC) still needs to be experimentally confirmed [PMC8174116]. In pancreatic cancer, hsa-mir-4772 has been reported as the second most abundant miRNA and a prognostic biomarker for tumor recurrence [PMC9138977]. Hsa-mir-4772 is included in a four-miRNA prognostic model for PDAC, along with hsa-mir-424, hsa-mir-126, and hsa-mir-3613 [PMC8174116]. The expression levels of hsa-mir-4772 are found to increase with higher risk scores, indicating its association with high-risk PDAC cases [PMC8174116]. Hsa-mir-424 and hsa-miR-3613 are also downregulated in PDAC and have target genes that are potential biomarkers for the disease [PMC8174116].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGAUCAGGCAAAAUUGCAGACU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications