Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-195 precursor URS000040EE1D_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR195: MIR195 is a subset of miRNAs that has been studied in relation to its expression in MIN6B1 cells and rat pancreatic islets. Agarose gel electrophoresis was conducted at different N/P ratios to confirm the condensation of MIR195 with FasudilSHPMIR195 [PMC4990390]. The expression of MIR195, along with other miRNAs such as miR34a, miR96, miR145, miR146, and miR210, was further analyzed using quantitative RT-PCR in a large series of samples obtained from MIN6B1 cells and freshly isolated rat pancreatic islets [PMC2551683]. References: - [PMC4990390]: The reference provides information on the agarose gel electrophoresis conducted at different N/P ratios to confirm the condensation of MIR195 with FasudilSHPMIR195. - [PMC2551683]: The reference provides information on the analysis of the expression of MIR195 and other miRNAs using quantitative RT-PCR in samples obtained from MIN6B1 cells and rat pancreatic islets.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGCUUCCCUGGCUCUAGCAGCACAGAAAUAUUGGCACAGGGAAGCGAGUCUGCCAAUAUUGGCUGUGCUGCUCCAGGCAGGGUGGUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications