Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, C/D box 57 (SNORD57) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, C/D box 57 (SNORD57) URS0000406CED_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD57: SNORD57 is a box C/D small nucleolar RNA (snoRNA) that is known to modify 18S rRNA and the protein of its host gene, Nop56, is a component of the box C/D ribonucleoprotein complex [PMC5454292]. It is found in the serum of colorectal cancer (CRC) patients and has been mis-annotated as piR-54265 [PMC8750603] [PMC8762274]. SNORD57 has been identified as a potential biomarker for periodontitis diagnosis and for severity of symptoms such as headache and dizziness [PMC9210629] [PMC7533415]. It has also been found to be highly upregulated in invasive breast cancer cell lines [PMC8445368]. SNORD57 is located within the NOP56 gene and its full-length sequence has been detected in human plasma, suggesting its potential as a serum/plasma biomarker for CRC [PMC7962485]. The expression patterns of SNORD57, along with other snoRNAs such as Snord14d and Snord35b, show cyclical patterns in mammalian liver with peak expression at ZT16 [PMC5454292] [PMC6276099] [PMC5514026]. SNORD57 has also been found to interact with other snoRNAs such as SNORD50 and SNORD34, suggesting potential functional relationships between these molecules within cells [PMC5389715]

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGAGGUGAUGAACUGUCUGAGCCUGACCUUGUAGAAUGGAGGCAAAAAAACUGAUUUAAUGAGCCUGAUCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

2D structure Publications