Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, C/D box 38B (SNORD38B) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, C/D box 38B (SNORD38B) URS000040478E_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD38B: SNORD38B is a small nucleolar RNA (snoRNA) that has been used as an endogenous control in various studies [PMC5017778]. However, it has been suggested that SNORD38B may not be suitable for semen identification [PMC6778116]. In one study, SNORD38B was used as a standard to quantify miRNA expression in the N group [PMC8226152]. SNORD38B, along with SNORD49A, has been used as a reference gene for normalization in miRNA expression analysis [PMC4601870]. It has also been used as a housekeeping gene to normalize the CT values of individual miRNAs [PMC5141567]. In liquid biopsies, the relative expression of miRNAs was calculated using SNORD38B as a reference [PMC6936051]. SNORD38B is one of the reference genes commonly used for data normalization in miRNA studies. It is often included along with other reference genes such as SNORD44, SNORD49A, and U6 snRNA [PMC9958881]. The stability of circulating miRNAs in exosomal vesicles makes them more suitable for normalization compared to snoRNAs like SNORD38B and small nuclear RNAs like U6 snRNA [PMC4601870]. In some studies, SNORD38B has been used alongside other endogenous controls such as UniSp6 and U6 snRNA for data normalization [PMC7398106]. The expression levels of miR-16 together with SNORD38B have also been analyzed in order to be adopted as reference genes in certain contexts [PMC6769746]. Overall, while there have been some concerns about its suitability for certain applications such as semen identification, SNORD38B remains commonly used and accepted as an endogenous control or reference gene in various miRNA studies.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCUCAGUGAUGAAAACUUUGUCCAGUUCUGCUACUGACAGUAAGUGAAGAUAAAGUGUGUCUGAGGAGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

2D structure Publications