Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-517c-3p URS00003FBECA_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-517c: Hsa-mir-517c is a microRNA that has been observed to have increased expression in placental weight and is overexpressed in mothers with placental malaria compared to non-infected ones [PMC9198802]. It has been visualized inside both PLAP positive and PLAP negative STBEVs [PMC5496854]. Hsa-mir-517c, along with hsa-miR-517a/b, plays an important role in preeclampsia development by regulating placental and trophoblastic function [PMC8666996]. It has also been associated with impaired spermatogenesis in patients [PMC6024298][PMC4370750][PMC3120834]. Hsa-mir-517c, along with hsa-miR-205, hsa-miR-221, and hsa-miR-519a, has been identified as a candidate regulator of Wnt signaling [PMC3240594]. However, it cannot be used as a target gene for hsa-miR-520f, hsa-miR-147, hsa-miR-181d, hsa-miR-9*, hsa-miR-627, hsa-miR126, or hsa-mir517c [PMC8612537]. HsamiRNA 517c is highly expressed at the end of pregnancy and is part of the C19MC cluster [PMC4710532][PMC9851797].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUCGUGCAUCCUUUUAGAGUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

  1. Macaca mulatta mml-miR-517a
  2. Pongo pygmaeus (Bornean orangutan) ppy-miR-517c-??
Publications